ID: 1098808719

View in Genome Browser
Species Human (GRCh38)
Location 12:75055741-75055763
Sequence TCCAATCAGTGACCATGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 99}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098808715_1098808719 20 Left 1098808715 12:75055698-75055720 CCATGTATTTAATTACAGAGAAT 0: 1
1: 0
2: 1
3: 22
4: 317
Right 1098808719 12:75055741-75055763 TCCAATCAGTGACCATGAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 99
1098808718_1098808719 -5 Left 1098808718 12:75055723-75055745 CCAGGACTCTTATTTTTTTCCAA 0: 1
1: 0
2: 1
3: 58
4: 570
Right 1098808719 12:75055741-75055763 TCCAATCAGTGACCATGAGTTGG 0: 1
1: 0
2: 0
3: 9
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098808719 Original CRISPR TCCAATCAGTGACCATGAGT TGG Intronic
900813597 1:4826552-4826574 TTCCGTCAGTGACCATGTGTTGG + Intergenic
901005833 1:6171107-6171129 ACCAGTCAGTGACCATGTGCTGG - Intronic
903125420 1:21244379-21244401 TTCAATGAGTAACCATTAGTCGG + Intronic
910008048 1:82424427-82424449 TTCAAGAAGTCACCATGAGTTGG + Intergenic
912849555 1:113110737-113110759 ACCAATTAGAGACCATAAGTGGG - Intronic
916528166 1:165631095-165631117 CCCAACCAGTGGCCCTGAGTTGG + Exonic
918418926 1:184342219-184342241 TGCAATAAGTGGCCATTAGTGGG - Intergenic
919357318 1:196540348-196540370 TCAAATCAGGGACCATGTTTGGG + Intronic
924282934 1:242456203-242456225 TCCATTCAGTGACTCTGAGCTGG + Intronic
1063407407 10:5809753-5809775 TCCAATCAGGTACCATGGGAGGG + Intronic
1067248955 10:44571303-44571325 TCCATTCAGGCACCATGGGTGGG - Intergenic
1073831881 10:107394057-107394079 TCCAGTCAGTGAACATTAGCGGG + Intergenic
1074527176 10:114272827-114272849 TCCCATCAGTGACGATGATGAGG - Exonic
1078861056 11:15246906-15246928 TGCACTCAGTGACCTTGCGTTGG + Exonic
1080389668 11:31833411-31833433 TCTTATCAGTGTCCATGAGAAGG + Intronic
1080394509 11:31877324-31877346 TCCAATCAGAGGCATTGAGTCGG - Intronic
1080693772 11:34583257-34583279 AACAATCAGTTATCATGAGTTGG + Intergenic
1096953125 12:55496494-55496516 TCAAATCAGTGGCCAGGTGTAGG - Intergenic
1098808719 12:75055741-75055763 TCCAATCAGTGACCATGAGTTGG + Intronic
1099394381 12:82120371-82120393 TCCAATCCGTGAGCATGAAATGG - Intergenic
1100930948 12:99608889-99608911 TCCATTCAGTTTCCTTGAGTGGG - Intronic
1105296623 13:19092143-19092165 TCAAATCAATGACAATGGGTAGG - Intergenic
1105388113 13:19950914-19950936 TCCAACCAGTGGCCAGGAGGTGG + Intergenic
1106278741 13:28242777-28242799 TCCAATCTGTGAACATGGATGGG + Intronic
1108709545 13:53018988-53019010 TCTAAGCACTGAGCATGAGTGGG - Intergenic
1110296473 13:73872145-73872167 TCAAATCATTGACCATGAACAGG - Intronic
1111942650 13:94628340-94628362 TCCAATCAGTGACTATTAATGGG - Exonic
1113882800 13:113637054-113637076 ACCAATCAGCTACCATCAGTGGG - Intronic
1130048328 15:80463231-80463253 TCTTATCAGTTACCATGTGTGGG + Intronic
1144401069 17:14902501-14902523 TGCAATCAGTGTCCATCAGTTGG + Intergenic
1146630081 17:34463433-34463455 TGAAATCAGTGCTCATGAGTGGG + Intergenic
1148728715 17:49816779-49816801 TCCATTCAGTGGCTCTGAGTTGG - Intronic
1153398557 18:4654263-4654285 TCCAATTATTGACCAAAAGTAGG - Intergenic
1155053486 18:22167025-22167047 TACAATCTGTGACCATGAAAAGG + Intergenic
1157215736 18:45781988-45782010 TCCAAACAGTGACCAAAAGAAGG + Intergenic
1158011031 18:52728039-52728061 TCCAATCACTGACCAAGAATTGG - Intronic
1158229557 18:55238739-55238761 TCCAATCTGTCATCATGAGAGGG - Intronic
1162483378 19:10942939-10942961 TCCAATCTGTGACCTTGCTTAGG + Intergenic
1163898163 19:20077917-20077939 TCCAATCAGGGACGCTGGGTTGG + Intergenic
1163999225 19:21082115-21082137 TCCAATCAGCGACGCTGGGTTGG + Intergenic
1164004424 19:21135619-21135641 TCCAATCAGTGACTCTGGGCTGG - Intergenic
1164023477 19:21329420-21329442 TCCAATCAGGGACTCTGAGCTGG - Intronic
1164226499 19:23250454-23250476 TCCAATCAGGGACCCTGAGCTGG - Intergenic
1164539577 19:29112834-29112856 TTCCATCAGTGACAATGACTGGG - Intergenic
1165381381 19:35483347-35483369 TCCATGCAGTGACCCAGAGTAGG - Intergenic
925988443 2:9234642-9234664 TCTAATCAGTTAAAATGAGTAGG + Intronic
926258904 2:11238308-11238330 TCCAATCCGTGTACATGAGGTGG - Intronic
929823548 2:45292334-45292356 TACAATCAGAGACCATGAAAGGG + Intergenic
929834529 2:45382991-45383013 TCAAATCAGTCATAATGAGTTGG - Intergenic
931752279 2:65340456-65340478 TCCAGTCATTGCCCATGTGTAGG - Intronic
934686717 2:96326706-96326728 TCCGATCACTGACCATCAGAGGG - Exonic
940043381 2:149384513-149384535 CCCAACCAGTGCCCATGACTGGG - Intronic
941086854 2:161127917-161127939 TCCAACCACTGTCCATGAGTAGG - Intergenic
941191653 2:162391493-162391515 GCCAGTAAGTAACCATGAGTTGG - Intronic
944180854 2:196891548-196891570 TCTTATTAGTGACCATTAGTGGG - Intronic
1170813601 20:19694752-19694774 CCCAATCAATGCCCAGGAGTAGG + Intronic
1172346845 20:34208737-34208759 TCCAATCTATGAACATGAGATGG + Intronic
1175020354 20:55840880-55840902 TCCAATCCATGAACATGAGATGG - Intergenic
1179354626 21:40647919-40647941 GCCAAACAGTGACGCTGAGTGGG + Intronic
1179476457 21:41649404-41649426 TTCAATCAGTGTCCATTTGTTGG - Intergenic
1183408511 22:37641732-37641754 TCCAATCAGTGCGCAAGAGCAGG + Intronic
950893318 3:16424595-16424617 TCCTATCATCGACCATGAGTTGG - Intronic
953906073 3:46868852-46868874 TCCAAAGAGTGAGCATCAGTTGG + Intronic
953931178 3:47006538-47006560 TGAAATCAGTGACCTTGATTAGG - Intronic
956868269 3:73390707-73390729 TCCACTCAATGAACACGAGTTGG + Intronic
957395460 3:79630995-79631017 TCCAATCAGTAAACATGGGATGG - Intronic
959494573 3:107035319-107035341 TCCAGTCAGTGAACAGGAGCAGG + Intergenic
966072227 3:175893128-175893150 TCAGATCAGTGATCATGAGATGG + Intergenic
970655543 4:18226509-18226531 TCTAATCAGTTACCATTAGTTGG + Intergenic
972037111 4:34538985-34539007 TCTCATCAGTAACAATGAGTAGG + Intergenic
975910818 4:79264958-79264980 TTCAAACAGAGAACATGAGTAGG - Intronic
976431560 4:84967275-84967297 TTCCGTCAGTGACCTTGAGTCGG + Intergenic
979849651 4:125560210-125560232 TCCAATCAGTCTCCCTGATTTGG - Intergenic
981534211 4:145782493-145782515 TCCAATCAGTCACCAGAAGCTGG + Intronic
981556195 4:145997662-145997684 TCCAATCCATGAACATGAGATGG + Intergenic
983437819 4:167737832-167737854 TCCATTCAGGGACCATGTGTAGG - Intergenic
986161362 5:5232416-5232438 TCCGACCAGTGGCCATGGGTGGG - Exonic
987561402 5:19526555-19526577 TCCATTCAATGTCCATAAGTGGG - Intronic
993034955 5:82746435-82746457 TCCAATCAGCCACCATTACTGGG - Intergenic
998454460 5:142260493-142260515 TTCAAACAGTGACAAGGAGTAGG - Intergenic
1003055920 6:2820279-2820301 TCCAATCTGTCACCCTGAGGAGG - Intergenic
1004879841 6:19996420-19996442 TACAATCTGTGACCTTGGGTTGG - Intergenic
1007004991 6:38352820-38352842 ATGAATCAGTGATCATGAGTTGG - Intronic
1008198053 6:48550250-48550272 TTCAATCTGTGACAATGTGTTGG + Intergenic
1019897923 7:3997688-3997710 GTCAATGGGTGACCATGAGTGGG + Intronic
1021807106 7:24368372-24368394 CAGAATGAGTGACCATGAGTTGG - Intergenic
1026175486 7:67992913-67992935 TCTAATCAGGGACTATGTGTAGG + Intergenic
1029559584 7:101293717-101293739 TCAAATCAGTCTCCCTGAGTCGG + Intergenic
1030362043 7:108605338-108605360 TCTGATCAGTGACCAAAAGTGGG - Intergenic
1032823124 7:135543104-135543126 TCCATTCGGTCACCATGAGCAGG + Intergenic
1033714786 7:143989032-143989054 TTCAATCACTGCCCATGAGGTGG + Intergenic
1035889857 8:3331375-3331397 TGCTAACAGTGGCCATGAGTTGG + Intronic
1036410450 8:8494924-8494946 TAAAATAAGTGACCAGGAGTTGG + Intergenic
1037154254 8:15680204-15680226 TCCAATCCATGAGCATGGGTTGG + Intronic
1041051817 8:53941802-53941824 TCCTATCAGTGGGGATGAGTTGG - Intronic
1041518858 8:58732615-58732637 ACCAATCAGTGACCAGGAGAAGG - Intergenic
1042482356 8:69318449-69318471 TCCATTCAGTTACCAAGAGGAGG + Intergenic
1042774375 8:72413730-72413752 TTCAATGAGTGAGCATGAATGGG + Intergenic
1044818913 8:96142999-96143021 TTCAAACATTGCCCATGAGTAGG - Exonic
1052641981 9:31180395-31180417 TTCAAGAAGAGACCATGAGTTGG - Intergenic
1061173012 9:128972795-128972817 GCCAACCAGTGACAACGAGTAGG - Intronic
1062225066 9:135445584-135445606 TCCACTCTGTCACCATGAATTGG - Intergenic
1188215813 X:27475776-27475798 TCTAATCACTGACAATGTGTTGG - Intergenic
1189276616 X:39790968-39790990 TCCAATCAGAGCCAATGAGATGG + Intergenic
1189402420 X:40683695-40683717 TTCAGTCAGTGACCAAGATTTGG - Intronic
1194339378 X:92690782-92690804 TCCAATCAGTGACCTGCAATTGG - Intergenic
1199863566 X:151823054-151823076 TCCAATCAGTCCCTAAGAGTAGG - Intergenic
1200647763 Y:5807562-5807584 TCCAATCAGTGACCTGCAATTGG - Intergenic
1201901355 Y:19048098-19048120 ACCAAAAACTGACCATGAGTTGG + Intergenic