ID: 1098811719

View in Genome Browser
Species Human (GRCh38)
Location 12:75102975-75102997
Sequence AGGTTTTCACAGTAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 254}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098811719 Original CRISPR AGGTTTTCACAGTAGGAGAA AGG Intronic
900362560 1:2296826-2296848 AGGTTTTCACAGCAGGAACGTGG - Intronic
903314460 1:22490590-22490612 AGGTTTGCACAGCAGGGGAGGGG - Exonic
904338963 1:29820439-29820461 AGAGTTTCACAGCATGAGAAGGG - Intergenic
904594202 1:31632810-31632832 AGGTGTCCAGAGTAGGAGGACGG - Intronic
905339657 1:37269794-37269816 AGGCTTTATCAGTAGGAGTATGG + Intergenic
907597763 1:55735408-55735430 AGATTGTCACAGTAGGAGAGGGG - Intergenic
909078442 1:71081028-71081050 ATGTCTTCACAGGAGGAAAACGG + Exonic
909081163 1:71113956-71113978 AGATTTTCACAGGAGGACAATGG - Intergenic
910066733 1:83162458-83162480 AGGTTTACTCAGAGGGAGAAAGG - Intergenic
910524427 1:88161576-88161598 AGGTTTTCACAGCAAGAGACAGG + Intergenic
911441085 1:97926378-97926400 AGTTTTTTAAAGTAGAAGAATGG + Intergenic
911638714 1:100264999-100265021 AGGCTTTGGCAGTAGGAGAAGGG - Intergenic
913077635 1:115354276-115354298 CTGTTTTCCCAGTAAGAGAAAGG - Intergenic
913244519 1:116859988-116860010 AGGCTTCCACTGTTGGAGAAGGG - Intergenic
915740999 1:158118266-158118288 AGGTTGCCATACTAGGAGAAGGG + Intergenic
918123523 1:181560588-181560610 GTGTTTTAACAGTAGGGGAATGG - Intronic
920199246 1:204249369-204249391 AGGGTTCCTCAGCAGGAGAAAGG - Intronic
922341648 1:224661537-224661559 AGATTTTCAAAGTAGGTAAATGG + Intronic
923106647 1:230858918-230858940 AGGGGGTCACAGGAGGAGAAAGG + Intronic
924170817 1:241338621-241338643 AGGCTTTCACTGTAGGAAAATGG + Intronic
924953349 1:248906010-248906032 AGGTTTCCAAAGTAGGACAGGGG + Intergenic
1063803984 10:9616248-9616270 AGATTTTCAATGTAGGTGAAAGG - Intergenic
1064344286 10:14516814-14516836 GGGTTGTCACTGTAGGAGGAGGG + Intergenic
1068506803 10:57910813-57910835 TGGAATTCACAGTAGTAGAAAGG - Intergenic
1068601283 10:58959448-58959470 AAATTTTCAAAGTAAGAGAAGGG - Intergenic
1071053435 10:81479504-81479526 AGGTTTGCCCACTAGGAGAGTGG + Intergenic
1075381527 10:122022783-122022805 AGGTTTTCACAATTGAAGAATGG + Intronic
1077965007 11:7120436-7120458 AGTTTCTCACTGTAAGAGAAAGG + Intergenic
1078537800 11:12189060-12189082 AGGTTCTCAGAGTGGGAGAATGG - Intronic
1078770786 11:14349564-14349586 AGTTTCTCACTGTTGGAGAAGGG - Intronic
1078859109 11:15230992-15231014 AGGTGTGCAGACTAGGAGAAGGG - Intronic
1078961582 11:16279111-16279133 AGCTTTTCAGAGTAAAAGAATGG - Intronic
1079141424 11:17812592-17812614 AGGATTGAACAGGAGGAGAATGG - Intronic
1079343540 11:19632698-19632720 TAGTTTTCTAAGTAGGAGAAAGG - Intronic
1080420216 11:32103286-32103308 ATGTTTTCCCATGAGGAGAATGG + Exonic
1080515932 11:33020101-33020123 AGGTTTTCACAGTAGGACTAGGG + Intronic
1081075736 11:38671202-38671224 AGATTTACAGAGTAGAAGAAAGG + Intergenic
1081579998 11:44345671-44345693 AGGTTTTCTCAGCAAGAGAATGG + Intergenic
1084375999 11:68778105-68778127 AGGTTTTCTATGTAGGAAAAAGG - Intronic
1084755495 11:71235954-71235976 CAGTTTTCTCAGCAGGAGAATGG - Intronic
1085807085 11:79646260-79646282 GAGTTTTTACAGTAGGGGAAAGG - Intergenic
1087976333 11:104552293-104552315 TTTTTTTCACAGTTGGAGAAGGG - Intergenic
1088445896 11:109928147-109928169 AGGGTTTCAGAGTAGGAGGGAGG - Intergenic
1089173211 11:116529884-116529906 AGTTTGTCACAGCAGGGGAAGGG + Intergenic
1089473629 11:118740805-118740827 ATCTTATCTCAGTAGGAGAATGG + Intergenic
1089999373 11:122941387-122941409 AGGTTTTCACTGTTGGAAAAAGG - Intronic
1090712788 11:129402964-129402986 AGGTATTCAGATGAGGAGAATGG + Intronic
1090992523 11:131832026-131832048 AAGCTTCCACTGTAGGAGAATGG - Intronic
1092891212 12:12970917-12970939 GGGTTTTCAAAGTGGGAGAGAGG + Intergenic
1093920674 12:24856187-24856209 GGGGTTTTACAGTGGGAGAAAGG - Intronic
1094158696 12:27366795-27366817 AGGTTCTAACAATAGGAGAGTGG + Intronic
1095958957 12:47821655-47821677 AGATTTCAACAGAAGGAGAAAGG - Intronic
1097427250 12:59461681-59461703 ATGTTTTGTCAGAAGGAGAAAGG + Intergenic
1097901278 12:64875818-64875840 ACCTTTTCACAGTAGTATAAGGG + Intronic
1098728376 12:73999036-73999058 TGTTTGTCACAGCAGGAGAATGG - Intergenic
1098811719 12:75102975-75102997 AGGTTTTCACAGTAGGAGAAAGG + Intronic
1099389921 12:82067617-82067639 AAGTATTCACAGTAGCACAATGG + Intergenic
1101818023 12:108160798-108160820 AGGATTTCTCAATAGGAGAGGGG + Intronic
1104481360 12:129110933-129110955 TGGTTTTCACAGTGGGAGCTGGG - Intronic
1105831686 13:24167919-24167941 ATGTCTCCACAGTAGGAAAAGGG - Intronic
1106221487 13:27749434-27749456 AGGTTTTCATAGTAAGGGGAGGG - Intergenic
1106288863 13:28342349-28342371 AGGAGTTCAAAGGAGGAGAAGGG - Intronic
1107942896 13:45390631-45390653 ATGTTTTCCCATGAGGAGAATGG - Intergenic
1108487977 13:50946598-50946620 TTGTTTTAAAAGTAGGAGAAGGG + Intronic
1108675612 13:52735470-52735492 AGGTTGTCACACTAGAAGAGTGG + Intronic
1108910034 13:55537485-55537507 AGTCTTTCACACTAGGAGTAGGG - Intergenic
1109224761 13:59679585-59679607 AGGTTCTGACAGCAGGAAAATGG + Intronic
1110653411 13:77969653-77969675 ATGTTTTGAAAGTAGGATAAGGG - Intergenic
1112426878 13:99310432-99310454 AGTTCTTCACAGTATGAAAAAGG + Intronic
1113445963 13:110367064-110367086 AGGTTTGCATTCTAGGAGAATGG + Intronic
1113916497 13:113877130-113877152 AGGGTTTCAAAGCAGGAGAGAGG - Intergenic
1114440023 14:22738800-22738822 AGTTTTTTGCAGTGGGAGAAAGG + Intergenic
1116899373 14:50347263-50347285 AGTTTTTCACTGTTGGAGAAGGG + Intronic
1117211525 14:53505744-53505766 AGATTTTCTCAGCAAGAGAAAGG - Intergenic
1117425649 14:55593172-55593194 AGGTTTTCTAAGTAGCAAAAGGG - Intronic
1118702223 14:68444733-68444755 CTGTTCTCACAGTAGGAGCAGGG + Intronic
1120699508 14:87683222-87683244 AGGTTTTTACTGTCAGAGAAAGG + Intergenic
1120752447 14:88210495-88210517 AGGATTTCAGAGTAGAAAAAAGG + Intronic
1120964478 14:90155404-90155426 TGGTTTTCACACCAGGTGAATGG + Intronic
1122673588 14:103391138-103391160 TGGTTATCACAGCTGGAGAAAGG + Intronic
1122985057 14:105208182-105208204 AGGTTATCACAGAAGGGGGAGGG - Intergenic
1125117371 15:36110659-36110681 TGGTTTTCAAAGGAGCAGAAGGG + Intergenic
1125237834 15:37536473-37536495 GTATTTTAACAGTAGGAGAAGGG - Intergenic
1126077723 15:44929369-44929391 AAGTTTTCACAGTAGCCAAAAGG + Intergenic
1126080930 15:44960793-44960815 AAGTTTTCACAGTAGTCAAAAGG - Intronic
1126543969 15:49852526-49852548 ATGTTTTCATAGTAAAAGAAAGG - Intergenic
1127291531 15:57575432-57575454 AGCTTTTCAGAGTAGCGGAATGG - Intergenic
1129829564 15:78659747-78659769 AGGTCTTCAAATTAGGAAAAGGG + Intronic
1130544345 15:84843521-84843543 AGGTTTGTACCCTAGGAGAAAGG + Intronic
1132317254 15:100899113-100899135 TGGCTTTCACAATGGGAGAAAGG + Intronic
1134683675 16:16144028-16144050 AGGTCCCCACAGTGGGAGAAGGG + Intergenic
1135134041 16:19874661-19874683 GGGTTGTCACAGTTGGAGGAGGG - Intronic
1136120405 16:28129342-28129364 AGCTTTTCACAGTGGGACACTGG - Intronic
1136512824 16:30749309-30749331 AGGTTTTCTCAGGAGAAGACTGG + Intronic
1137667992 16:50262834-50262856 GGGCTTTCACAGTAGCAGACAGG - Intronic
1138020909 16:53480487-53480509 ATTTTTTAAAAGTAGGAGAAAGG - Intronic
1138035143 16:53596740-53596762 AGGTGCCCACAGAAGGAGAAGGG - Intergenic
1138166776 16:54809389-54809411 AGGACTTCACAGTAAGAGTATGG + Intergenic
1139517731 16:67461710-67461732 AGGCACTCACAGTAGGGGAATGG + Intronic
1139741942 16:69042829-69042851 AGTTGTTAACAGTAGGGGAATGG + Intronic
1140843784 16:78867062-78867084 AAGTATTCACAATTGGAGAAGGG + Intronic
1140925230 16:79576044-79576066 AGGTTTTTACAGTGGGGTAAAGG - Intergenic
1141764226 16:86048090-86048112 TGGTTGTCACAGGCGGAGAAGGG + Intergenic
1142862134 17:2768913-2768935 TTGATTTCACAGCAGGAGAAGGG - Intergenic
1142974883 17:3637210-3637232 GGGTTTTCACACTGGGCGAAGGG + Exonic
1143454014 17:7054127-7054149 ACGTTTTGACAGTAGGGGAGAGG - Intergenic
1143925654 17:10366958-10366980 AGGTTTTCATAGTAAGGGACTGG + Intronic
1145371058 17:22306189-22306211 AGGTTTTCAGAGGATGGGAATGG + Intergenic
1147915885 17:43885586-43885608 AAGTTCTCACTGAAGGAGAAGGG - Intronic
1153739708 18:8111090-8111112 CAGTTTTCACATTAGGAAAATGG + Intronic
1153739860 18:8112580-8112602 AGTTTTTCTCAGCATGAGAAAGG + Intronic
1153773489 18:8433592-8433614 AAGTTTTCACAGTGGTGGAAAGG + Intergenic
1155936683 18:31761941-31761963 AGCTTTTCACGGAAAGAGAAGGG + Intergenic
1156405772 18:36781344-36781366 AGGTTTTAAAAGTAGGACAAAGG - Intronic
1159039299 18:63308359-63308381 AGGTTCTCACAGTGGGAGCAAGG - Intronic
1159893176 18:73972066-73972088 AACTATTCACAGTAGGGGAAGGG - Intergenic
1160451433 18:78969014-78969036 GGGTTCTCACAGCAGGAGAGAGG - Intergenic
1161783998 19:6311909-6311931 AGGTTATCAAAGTAGGATCAAGG + Intronic
1163761241 19:19137891-19137913 AGGTTCTCAGAGTGGGAGACAGG - Intronic
925221482 2:2144857-2144879 AGGTTTGCAGAGCAAGAGAAAGG - Intronic
925651558 2:6094836-6094858 AGGTTTTCAATGTAGGCAAAAGG - Intergenic
925935561 2:8755588-8755610 AGGTTTTGTCAGTATCAGAAAGG - Intronic
929925796 2:46207260-46207282 AGGTTTTCAAAGGATGAGAGGGG - Intergenic
933563653 2:83921676-83921698 GGTCTTTCACAGTTGGAGAAGGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
938983393 2:136548250-136548272 AGATTTTAACAGTGGAAGAAGGG - Intergenic
940497194 2:154446633-154446655 AGGTTTCCACAGTAGGATGCTGG - Intronic
940713376 2:157189691-157189713 CGGTTTTCATAGTAGGTGTATGG - Intergenic
943131466 2:183858363-183858385 AGGTTTTCAAAGCATGAAAAGGG - Intergenic
944684272 2:202104510-202104532 TGGTTTTCACAGAAGGAATATGG + Intronic
945081795 2:206093491-206093513 AGGGTTACACAGTAGGAAAATGG - Intergenic
946161078 2:217836388-217836410 AGGTTTTCTCTGCAGGAGAGGGG + Intronic
947163673 2:227240131-227240153 TGGTTTTAACAGGGGGAGAAGGG + Exonic
1170152500 20:13239999-13240021 AGGTTGTTACAGGAGCAGAAAGG + Intronic
1170632718 20:18079230-18079252 AGGTTTTTACAATAGAAGATGGG + Intergenic
1170925255 20:20717095-20717117 AGATTTTCAGTGTAAGAGAAAGG + Intergenic
1172032020 20:31989029-31989051 ATGGATTCACAGTGGGAGAATGG + Intronic
1172308084 20:33895960-33895982 GGGTGTTCAAAGGAGGAGAAGGG + Intergenic
1172409647 20:34711636-34711658 AGGTATTTACTGGAGGAGAAGGG - Exonic
1173690329 20:44955975-44955997 AGATTGTCTCAGAAGGAGAAAGG - Intronic
1175147037 20:56904779-56904801 AGATATTCAAAGTATGAGAAGGG + Intergenic
1178564290 21:33668863-33668885 AGGTTTTCAAAGAAGCAGGACGG - Intronic
1179106491 21:38405087-38405109 AGGTGTTTGCAGTAGGAGAATGG - Intronic
1179657135 21:42852449-42852471 AGGTCTCCACAGAAGGTGAATGG - Intronic
1181148151 22:20863470-20863492 CAGGTTTCACAGTAGGAGAAGGG - Intronic
1181204321 22:21240202-21240224 AGGTTTTCAGTCTGGGAGAAAGG + Intergenic
1182186545 22:28409110-28409132 AATTTTTCACAGCAGGAAAAGGG - Intronic
1185127765 22:49021354-49021376 AGGTCCTCCCAGCAGGAGAAGGG - Intergenic
1203222601 22_KI270731v1_random:55213-55235 AGGTTTTCAGTCTGGGAGAAAGG - Intergenic
1203268228 22_KI270734v1_random:31601-31623 AGGTTTTCAGTCTGGGAGAAAGG + Intergenic
949917215 3:8974452-8974474 AGATTGGCACAGGAGGAGAATGG - Intergenic
951179924 3:19647569-19647591 AGGTTGTTACAGCAGAAGAAGGG - Intergenic
951615464 3:24538483-24538505 AGGTTTTCAAAATAAGTGAAGGG + Intergenic
952001456 3:28790022-28790044 AGGCTTTCAAAATAGGAAAAAGG - Intergenic
952071624 3:29643905-29643927 AGGTTTTCAGAGAAAGAAAATGG - Intronic
952110846 3:30122625-30122647 TGGTTTTCACGGGAGGAGAGGGG - Intergenic
952160059 3:30684468-30684490 AGTTTTTCAGATTAGGAGTACGG - Intronic
952685616 3:36144627-36144649 AGGAATTCACAGTTGGAGTATGG - Intergenic
955522282 3:59786446-59786468 AGATTTTGTCAGTAGGAAAAAGG - Intronic
955552562 3:60100013-60100035 AGTTTTTCACAGTAGCACACTGG + Intronic
956782372 3:72614156-72614178 AGGTTTTCACAGTGGGTGCTGGG + Intergenic
957253127 3:77800061-77800083 ATGCTTTCACTGCAGGAGAAGGG - Intergenic
958452872 3:94295699-94295721 AGGTTTTCTTATTGGGAGAATGG - Intergenic
959158590 3:102696444-102696466 ATGTTTTCACAGCAAGAGAATGG - Intergenic
960124317 3:113981641-113981663 ACGATTTCACATTAGGAAAAGGG + Intronic
960318037 3:116201916-116201938 AGGTTTTCTGAGTAATAGAATGG - Intronic
960367336 3:116788727-116788749 AGGCCATCACAGTAGGATAAGGG - Intronic
960661892 3:120069298-120069320 AATTTTTCAGAGTAGGGGAAAGG + Intronic
962025216 3:131540708-131540730 AGTTTTTGACTGGAGGAGAAAGG + Intronic
962438066 3:135384621-135384643 AGGATTTAACAGTAGAAGAGAGG + Intergenic
964856377 3:161150398-161150420 AGGTTTTTGCAGCAGTAGAAAGG + Intronic
965498977 3:169434017-169434039 ACGTTTTGACACTTGGAGAATGG - Intronic
965628909 3:170710550-170710572 AGGTTTCCATAGGAGGACAATGG - Intronic
966077797 3:175959566-175959588 AATTTCTCACAGTGGGAGAAAGG - Intergenic
966905688 3:184524224-184524246 AAATTTTCACAGCAGGAGAATGG + Intronic
972795875 4:42419169-42419191 AGGATTGCTGAGTAGGAGAAAGG - Intronic
977931316 4:102752291-102752313 ACGTTTACAAAGTTGGAGAATGG - Intronic
978631208 4:110747488-110747510 GGGTGTTCACAGTTGGAGAATGG + Intergenic
980232504 4:130062521-130062543 AGATTTTCTCACTGGGAGAATGG - Intergenic
983553293 4:169037508-169037530 GTCTTTTCTCAGTAGGAGAAGGG + Intergenic
983706446 4:170666070-170666092 CAGTTGCCACAGTAGGAGAATGG + Intergenic
985351330 4:189065644-189065666 GGTATTTCTCAGTAGGAGAATGG - Intergenic
986019466 5:3787649-3787671 AGCATTTCACAGCAGGTGAAGGG - Intergenic
986689987 5:10306401-10306423 AGGTCTGCAAAGTAGGGGAAGGG + Intronic
992169588 5:74088399-74088421 AGTTTTTTTCAGTAGCAGAATGG + Intergenic
992344613 5:75864391-75864413 AGCTTTTCACTGCAGGAGATAGG - Intergenic
994171019 5:96660197-96660219 AGGTGTGAACAGAAGGAGAAGGG - Intronic
994225008 5:97241589-97241611 AGGTTTCCACCAAAGGAGAAAGG - Intergenic
996572794 5:124950511-124950533 AGGATTTCAAAGTAAAAGAAAGG - Intergenic
997146832 5:131443562-131443584 AGGTTTGTGCAGAAGGAGAAGGG - Intronic
997573880 5:134957838-134957860 AGGTTTTCCCTATAGGAAAAGGG - Intronic
998819674 5:146047427-146047449 AGGTTTTCATAGAGGGAGATGGG + Intronic
1000880033 5:166686833-166686855 GGTTTTTCACTGTTGGAGAATGG - Intergenic
1001099087 5:168799218-168799240 AGCTTTTCACACTAGGAGTCTGG - Intronic
1002202698 5:177539167-177539189 AGGGTTTCCCAGGAGGGGAAAGG + Intronic
1002580462 5:180207284-180207306 AGGTTCTCACTGCAGGAGAAAGG + Intronic
1002885403 6:1289446-1289468 TGGTTTTCTCACTAGTAGAATGG + Intergenic
1003637286 6:7844507-7844529 AGGTTCTACCAGTAGGAGGAAGG + Intronic
1005470696 6:26159507-26159529 AGGTTTTCACTGCTGGGGAATGG + Intronic
1006451147 6:34106452-34106474 TGGTTTTCACTCTATGAGAAGGG - Intronic
1008063804 6:47026445-47026467 ATATTTTCACAGGAGAAGAAAGG - Intronic
1008702326 6:54116005-54116027 AGGTTTTGAGAGTTGGAGCAGGG + Intronic
1009324171 6:62329494-62329516 ATGTTTTGAGAGTAGGAGAATGG - Intergenic
1009824039 6:68843866-68843888 AGGATTTCACTGTAGGTGTATGG - Intronic
1010760553 6:79717595-79717617 AGATTTTCACAGAAGGAAAACGG + Intergenic
1011208305 6:84925768-84925790 ATGTGTTCATAGAAGGAGAAAGG + Intergenic
1011450490 6:87486817-87486839 AGGGTATCACAGTAGTAGTATGG + Intronic
1012221030 6:96649569-96649591 AGCTTTGCACAGTGGGAGTATGG - Intergenic
1013827681 6:114234031-114234053 ATGTTTTCCAAGTTGGAGAACGG + Intronic
1016596145 6:145803645-145803667 AGGGTATCACAGAAGGAAAATGG + Intronic
1016617257 6:146065697-146065719 AGATTTTCAAAGTAAAAGAAGGG + Intronic
1016811001 6:148261364-148261386 ATGTTTTATAAGTAGGAGAAAGG - Intergenic
1018012262 6:159681849-159681871 TGGTTTTTGCAGTAGGAGAAAGG - Exonic
1018838212 6:167500953-167500975 AGGGTGGCACAATAGGAGAAGGG + Intergenic
1021049841 7:15969565-15969587 AGGTTATGAAAGAAGGAGAAAGG + Intergenic
1021270371 7:18577530-18577552 AGGTTCTGAGAATAGGAGAAAGG - Intronic
1022612520 7:31891132-31891154 AGATTGTCACAGAAGGAAAAGGG + Intronic
1023957406 7:44897896-44897918 AAGTATTAACAGTTGGAGAATGG + Intergenic
1024233552 7:47380869-47380891 AGGCTTTCACAGCAGGACAGTGG + Intronic
1027277372 7:76572301-76572323 AGGTTTACTCAGAGGGAGAAAGG + Intergenic
1027665423 7:81038550-81038572 AGATTTTAAAAGTAGAAGAAAGG + Intergenic
1028238228 7:88386359-88386381 AGGAATTCAAAGTAAGAGAAAGG + Intergenic
1028403215 7:90446847-90446869 AAGGATTCACAGTAGGAGATTGG - Intronic
1028417160 7:90593389-90593411 ATGTTTTTTCAGTAGGAGAATGG - Intronic
1030205103 7:106944808-106944830 AGGTTTTGACAGAAAGACAAAGG - Intergenic
1031018387 7:116600053-116600075 TGGTTTTCATAGTTGGAGACTGG - Intergenic
1031488786 7:122362676-122362698 AGGTTTTTTCAATAGGAAAAGGG + Intronic
1032098287 7:128951207-128951229 ATGTTTTGAGATTAGGAGAAGGG + Intergenic
1032963186 7:137064484-137064506 TGGGACTCACAGTAGGAGAATGG + Intergenic
1033215827 7:139492858-139492880 AGGTTTTCACAACAGGCTAATGG - Intergenic
1033511529 7:142064537-142064559 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1033514591 7:142093565-142093587 AGGTTGTGACAGCTGGAGAAGGG - Intronic
1034004395 7:147453115-147453137 AGGCTTTGCCAGCAGGAGAAAGG - Intronic
1034904217 7:154929708-154929730 AGGTCTTCACTGCTGGAGAAGGG - Intronic
1036156722 8:6348901-6348923 TAGTTTCAACAGTAGGAGAAAGG + Intergenic
1037512203 8:19594869-19594891 AGGTCCTGACAGTAGGAAAATGG - Intronic
1038484889 8:27927617-27927639 AGGATTCAACAGTAAGAGAATGG - Intronic
1038838593 8:31157620-31157642 AGGTTTTCATAATAGCATAAAGG - Intronic
1039141472 8:34393732-34393754 AGGTTAGAACAGTAGAAGAAAGG + Intergenic
1039894996 8:41710758-41710780 TGGTTTCCACAGTAAGAGAGTGG - Intronic
1039925987 8:41932882-41932904 AGGAAGTCACAGCAGGAGAATGG + Exonic
1039986045 8:42448769-42448791 AGCTGTTCACAGTAGGTGAGAGG + Intronic
1040995560 8:53397744-53397766 AGGTGTTAACAGTAGAGGAATGG + Intergenic
1043414875 8:80037000-80037022 CAGTTTTCAAAGTAGGAGACAGG + Exonic
1045119392 8:99019026-99019048 AGGTAATCACATTACGAGAAAGG - Intronic
1045153380 8:99435958-99435980 TGGTTTTCAAACCAGGAGAATGG + Intronic
1045729011 8:105212571-105212593 AGGGCTACACAGTAGGAGTAAGG - Intronic
1046024054 8:108700802-108700824 AGGTTTACACAGCTGGAGCATGG + Intronic
1047483298 8:125305281-125305303 AGGTTTTCACAGTAGTAAAATGG - Intronic
1048917618 8:139199775-139199797 GGCTTTTCACAGCAGGCGAAGGG + Intergenic
1050495752 9:6240000-6240022 TGGTTTTGACTGTAGGGGAAAGG - Intronic
1051316741 9:15843826-15843848 AGGTTTTCTCATGAGCAGAAGGG + Intronic
1052234983 9:26201221-26201243 AGGATTCATCAGTAGGAGAATGG + Intergenic
1052738135 9:32366015-32366037 GGATTTTCAAAATAGGAGAAAGG + Intergenic
1052837052 9:33258780-33258802 ACTTGTTCACAGTAAGAGAAAGG + Intronic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1055796714 9:79982428-79982450 ATATTTTGACAATAGGAGAAAGG - Intergenic
1055849224 9:80605404-80605426 AGGTTTTATTAGCAGGAGAAAGG + Intergenic
1058717906 9:107738880-107738902 TGGTTGTCACACTAGGAGTAAGG + Intergenic
1059694044 9:116713958-116713980 AAGTTTTCACATTAGGAAGATGG + Intronic
1059959073 9:119547555-119547577 AGGTTTTGACAGCATTAGAAGGG - Intergenic
1060389527 9:123267363-123267385 AGGTGGGGACAGTAGGAGAAGGG - Intronic
1060450315 9:123732507-123732529 AGGGGTTAAGAGTAGGAGAAGGG + Intronic
1060666911 9:125437150-125437172 TGCATTTCACAGTAAGAGAAGGG + Intergenic
1060851973 9:126885455-126885477 TGGTTTTCACATTAGGAAAATGG - Exonic
1060863037 9:126971899-126971921 AGATTTTCAAAATAGAAGAAAGG + Intronic
1061418982 9:130463171-130463193 CAGTTTTCACAGTAGGCAAAAGG + Intronic
1186021320 X:5259283-5259305 AGATTTTCACGGTAGAAGAGAGG - Intergenic
1192719676 X:73679022-73679044 AGGTTTTCACAGTAGTCCAGTGG + Intronic
1194764429 X:97832932-97832954 AGGTTCTCACTGTAGAAGAAGGG - Intergenic
1195000691 X:100640595-100640617 AGAATTTCAGAGAAGGAGAATGG - Intergenic
1195341174 X:103907520-103907542 AAGTTTTGTCAGTATGAGAACGG + Intergenic
1195623493 X:106983301-106983323 AGGTTTTCTCAGTAGGACACAGG + Intronic
1197069531 X:122279393-122279415 AGGTAGTCAACGTAGGAGAAGGG + Intergenic
1198299869 X:135324980-135325002 TGGTCCTCACAGTAGCAGAAGGG - Intronic
1198675594 X:139127133-139127155 AGGTTCTCACAGTAAGAAAGTGG - Intronic
1199661285 X:150053347-150053369 AGGAGTTCACAGGAGGAGACTGG + Intergenic
1199918126 X:152366926-152366948 AATTTTTCACTGTAGCAGAAAGG + Intronic
1201531569 Y:14995075-14995097 ATTTTTTCAAAGTAGGAAAATGG + Intergenic