ID: 1098814035

View in Genome Browser
Species Human (GRCh38)
Location 12:75134247-75134269
Sequence CATAGTGAACTGCCTATAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 89}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098814035 Original CRISPR CATAGTGAACTGCCTATAAT AGG Intronic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907888533 1:58616559-58616581 CAAACTGAATTGCCTTTAATTGG - Intergenic
908197790 1:61762171-61762193 CATAGGGAACTGACTATGACAGG - Intronic
916346271 1:163795077-163795099 CATAGTAAAGTGCTTATAATGGG - Intergenic
916985238 1:170183840-170183862 CATAGTGAAATTACTACAATGGG + Intergenic
918258900 1:182776275-182776297 CATAGTGTCCTGCCTAAACTTGG + Intergenic
919016910 1:192050188-192050210 TATATTGAACTGCGTATTATTGG + Intergenic
922848150 1:228706483-228706505 AACAGTTAACTGCCTATGATTGG + Intergenic
1062829385 10:595357-595379 CATAGGAAACTGCCAATATTTGG - Intronic
1062869155 10:883816-883838 CTACGTGAACTGCTTATAATGGG + Intronic
1065251296 10:23817221-23817243 CATAGTGAATTGCCTCTCATTGG + Intronic
1068445451 10:57116320-57116342 CTTAGTTAACTGCTTATATTGGG + Intergenic
1074222643 10:111453506-111453528 GATAGGGTACTGCCTATCATGGG + Intergenic
1074924925 10:118059135-118059157 CATAGTGCATTGCATGTAATAGG + Intergenic
1074947320 10:118293745-118293767 CTTCGAGACCTGCCTATAATTGG - Intergenic
1075488946 10:122849765-122849787 CATTGTGAACTCCTTAGAATGGG + Intronic
1077846267 11:6027806-6027828 AAAAGTGAACTACCTATCATTGG - Intergenic
1077934862 11:6772524-6772546 CATAGTTAACTCCCTCTAGTTGG - Intergenic
1078298073 11:10095209-10095231 CACAGTGTCCTGCCTATATTTGG + Intronic
1080440722 11:32292089-32292111 CATAGTGCACAGCCCATAATAGG + Intergenic
1080766608 11:35303077-35303099 CATAGGAAACTGGATATAATAGG - Intronic
1080814315 11:35739174-35739196 CATAATGAACTGTCAATAAATGG - Intronic
1086822417 11:91450252-91450274 CATAGACATCTGCCTATAATCGG - Intergenic
1090366975 11:126214568-126214590 AAAAGTGAACTGCCTAAAAAAGG - Intronic
1091986429 12:4912775-4912797 GATATTGACCTGTCTATAATGGG - Exonic
1092311000 12:7352633-7352655 CTTAGTGATCAGCCAATAATTGG - Intronic
1096961029 12:55577762-55577784 AATAGTGTCCTGCCCATAATAGG + Intergenic
1097263859 12:57735065-57735087 CATGTTGTACTGCCTAGAATTGG - Intronic
1098814035 12:75134247-75134269 CATAGTGAACTGCCTATAATAGG + Intronic
1099806710 12:87529488-87529510 AATAGTGAACTGCCTAAATGTGG - Intergenic
1102130757 12:110526942-110526964 CATACTGATCTGGCCATAATTGG - Intronic
1104644153 12:130485234-130485256 CATAGTGCCCTGCATATAGTAGG - Intronic
1105270246 13:18866749-18866771 TGTAATGAACTGCCTTTAATGGG - Intergenic
1108558435 13:51619873-51619895 CATAGTTGGCTGCCTATAGTTGG + Intronic
1108980109 13:56500119-56500141 AATAGAGAACTCCCAATAATTGG - Intergenic
1112986230 13:105453585-105453607 CATAGTAAGCTTCCAATAATGGG - Intergenic
1114844758 14:26308168-26308190 GAGAGTAAACTGCCTATAAAAGG + Intergenic
1116805799 14:49493087-49493109 CACAGTGAAATGCTTGTAATTGG + Intergenic
1117016604 14:51524851-51524873 CATAGTGAACTGTACCTAATTGG - Intronic
1117183175 14:53213318-53213340 CATAGTAAGCTGACTATACTAGG + Intergenic
1133468346 16:6049877-6049899 CACAGTGTACTGCCTTTATTTGG - Intronic
1134028528 16:10973457-10973479 CCTAGTGAAATGCCCAGAATAGG + Intronic
1139974505 16:70798306-70798328 CATAGATAACTGCCAATATTCGG + Intronic
1150960304 17:69905158-69905180 CAAAGTTAGCTGCCTATCATTGG - Intergenic
1152409470 17:80115821-80115843 CTTAGTGGACAGCCAATAATTGG + Intergenic
1154417790 18:14193216-14193238 TGTAATGAACTGCCTTTAATGGG + Intergenic
1155822416 18:30395128-30395150 CATAGTGACTTTCCTATTATAGG - Intergenic
1160309235 18:77773214-77773236 CATAGAGAAGTGCCGATTATGGG + Intergenic
1162072564 19:8163076-8163098 CATAGTGAGGTACCTAGAATTGG + Intronic
926060158 2:9800187-9800209 GATAGGGAACTGCCCAGAATTGG - Intergenic
932207942 2:69900423-69900445 GATTTTGAACTCCCTATAATAGG - Intronic
933531732 2:83518814-83518836 CATGGTGAACTGTCAATATTTGG - Intergenic
936774073 2:115951163-115951185 CATAGTGAACTGGCTAAAGGAGG - Intergenic
939892570 2:147755110-147755132 CACAGTGATCTGCCTATATGTGG - Intergenic
943175344 2:184466174-184466196 CATAATGAACTGCCTCCACTGGG + Intergenic
943838547 2:192548088-192548110 CATATTAAAGTGCCTAAAATGGG + Intergenic
945638248 2:212386924-212386946 CATAGTGGCATGGCTATAATAGG + Intronic
949077196 2:242068067-242068089 CATGGTGTAGTGCCTGTAATTGG - Intergenic
1170311595 20:14997875-14997897 CATGCTGAACTGCCTGGAATTGG - Intronic
1171416784 20:24986933-24986955 CATGGTGATCTGCCTATTCTAGG + Intronic
1176855514 21:13966056-13966078 TGTAATGAACTGCCTTTAATGGG - Intergenic
1182511952 22:30826227-30826249 CAAAGTGCACTGTCTATATTTGG + Intronic
952945532 3:38476057-38476079 CATTGTGGGCGGCCTATAATGGG + Intronic
955741652 3:62097289-62097311 CATCCTGAACTGCATTTAATAGG - Intronic
957503738 3:81092839-81092861 CATATTAAATTGCATATAATGGG + Intergenic
959468912 3:106724393-106724415 TATAAAGAACTGCCTAAAATGGG - Intergenic
963219927 3:142797783-142797805 CATAGTTAACTAACTATAAAAGG - Intronic
972891576 4:43562775-43562797 CATAGTTAACTGGTTAAAATAGG - Intergenic
977475141 4:97497279-97497301 TATAGTGAAATGATTATAATTGG - Intronic
980717741 4:136649893-136649915 CATAGTGTACTTCTTATATTAGG - Intergenic
984039997 4:174720183-174720205 CATATTTAACTGCCTATGATGGG + Intronic
990777975 5:59324592-59324614 CATAGTTATCTGCATGTAATAGG + Intronic
994556262 5:101309085-101309107 CATAGTGAACTGGTTACTATAGG + Intergenic
994708859 5:103241419-103241441 TATAGTGAACTGCACATAATAGG + Intergenic
995015729 5:107306621-107306643 CATTTTTTACTGCCTATAATAGG - Intergenic
995430836 5:112074827-112074849 AATAATGAACTGGCTATAATTGG + Intergenic
998636757 5:143963883-143963905 CATAGACAACAGCCTATAAAGGG - Intergenic
1007303412 6:40886055-40886077 TATAATGAACTCCCCATAATTGG - Intergenic
1010156174 6:72796155-72796177 AATAATGACTTGCCTATAATAGG - Intronic
1014669831 6:124288284-124288306 CACAGTGAACTGCCTCTTAGAGG + Intronic
1020842356 7:13234394-13234416 CAAATTGAACTGTCAATAATTGG - Intergenic
1022170588 7:27825172-27825194 AATAGTGAAATGCCTAACATTGG + Intronic
1030849665 7:114467655-114467677 CAAAGTGTACTAACTATAATAGG - Intronic
1033807952 7:144976064-144976086 CATCTTGAACTACCTATCATGGG + Intergenic
1035535749 8:389952-389974 CATGGTGTAGTGCCTGTAATTGG - Intergenic
1041534531 8:58911186-58911208 CAAAGGGAACTGCTTAAAATGGG - Intronic
1042713874 8:71750161-71750183 CATAGTAATCAGCCTATAGTTGG + Intergenic
1043789468 8:84446241-84446263 CATATTGAACTACCCATAATGGG + Intronic
1044490313 8:92805798-92805820 CATAGTGAAAAACCTAGAATAGG - Intergenic
1046969745 8:120208950-120208972 CATAGTGACTTGCATGTAATAGG - Intronic
1048537342 8:135309547-135309569 CACAGAGACCTGCCAATAATAGG - Intergenic
1056128341 9:83559607-83559629 CATATGGAACTGCCAATATTAGG - Intergenic
1057054659 9:91950833-91950855 AATAGTGTTCTGCCTTTAATGGG - Intergenic
1186578748 X:10794070-10794092 AATATTTGACTGCCTATAATGGG - Intronic
1186865814 X:13719638-13719660 CATAGTGAACTGAGTATGATGGG + Intronic
1193450570 X:81659676-81659698 CATTTTGAACTGCCTTTAAAGGG - Intergenic
1197272998 X:124446423-124446445 CATAGTGAGCTCTCTATAAGTGG + Intronic
1201297486 Y:12476794-12476816 TATAGTGAACTCCATATACTGGG - Intergenic
1201787392 Y:17800352-17800374 CATAGTGAACTGAATATCATAGG + Intergenic
1201814161 Y:18105636-18105658 CATAGTGAACTGAATATCATAGG - Intergenic
1202349288 Y:23970360-23970382 CACAGTGAACTGAATATCATGGG + Intergenic
1202521487 Y:25699744-25699766 CACAGTGAACTGAATATCATGGG - Intergenic