ID: 1098814087

View in Genome Browser
Species Human (GRCh38)
Location 12:75135303-75135325
Sequence CTGTGTGAATGTGATAATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 260}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098814086_1098814087 -4 Left 1098814086 12:75135284-75135306 CCATCACAAGTTCACAGCTCTGT 0: 1
1: 0
2: 0
3: 14
4: 198
Right 1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG 0: 1
1: 0
2: 3
3: 23
4: 260
1098814085_1098814087 1 Left 1098814085 12:75135279-75135301 CCTGACCATCACAAGTTCACAGC 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG 0: 1
1: 0
2: 3
3: 23
4: 260
1098814084_1098814087 2 Left 1098814084 12:75135278-75135300 CCCTGACCATCACAAGTTCACAG 0: 1
1: 1
2: 1
3: 10
4: 180
Right 1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG 0: 1
1: 0
2: 3
3: 23
4: 260
1098814083_1098814087 11 Left 1098814083 12:75135269-75135291 CCACTGAATCCCTGACCATCACA 0: 1
1: 0
2: 1
3: 41
4: 243
Right 1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG 0: 1
1: 0
2: 3
3: 23
4: 260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098814087 Original CRISPR CTGTGTGAATGTGATAATGA TGG Intronic
900570488 1:3355849-3355871 CTGTGTGTCTGTGAAAATCAGGG + Intronic
901134734 1:6985820-6985842 ATGTGTGAAAATGTTAATGAAGG - Intronic
901757186 1:11448581-11448603 CTGTGTGGCTGTGATAAGCAAGG + Intergenic
902731609 1:18373611-18373633 CTGTGTGCATCTGATCCTGAGGG - Intronic
905003824 1:34694589-34694611 CTGTGATAATGTCATAATCAAGG - Intergenic
905062648 1:35152846-35152868 CAGTGTGTCTCTGATAATGAGGG - Intergenic
905446631 1:38031830-38031852 CTGTGTGAATGTGAGAAGTGAGG + Intergenic
905804053 1:40863040-40863062 CTGAGTGAATGAACTAATGATGG + Intergenic
909352310 1:74668881-74668903 CTGTGTGAAAGAGATAATTTTGG + Intronic
909445117 1:75740347-75740369 CTGTTTGAATCTGATTAGGAAGG + Intronic
910004454 1:82379296-82379318 CTGTGTATAGGTGATAGTGAGGG + Intergenic
911482793 1:98465384-98465406 ATATGTGAAGGTGAAAATGAAGG - Intergenic
912159690 1:106966705-106966727 CTGTGTGAGTGTGGTAATGAAGG - Intergenic
913277461 1:117153187-117153209 CTCTGAGAATGTGACCATGAAGG - Exonic
914597992 1:149173397-149173419 CAGTTTGAATGTCATAAAGATGG - Intergenic
915888305 1:159747277-159747299 CTGTGTGAGGATGATAATGCAGG - Intergenic
916031833 1:160883677-160883699 CTGAGTGGATGTGACACTGATGG - Intronic
916326426 1:163565008-163565030 CTTTGAGAATGGGAGAATGAGGG + Intergenic
917742410 1:177973683-177973705 CCCAGTGCATGTGATAATGATGG - Intronic
920557195 1:206912865-206912887 CTGTGGCAATGTGAAAATGGAGG - Intronic
921631859 1:217443100-217443122 CTGTATAAAAGTAATAATGATGG - Intronic
922625278 1:227034387-227034409 CTGTGTAAATGGGGTAATGGAGG - Intronic
922854848 1:228766170-228766192 CTATGTGAAGGTGATAAGCAAGG - Intergenic
1062868956 10:881903-881925 CTGAGTGCAAGTGATCATGATGG - Intronic
1067004588 10:42648774-42648796 CTATGGGAATGGGATACTGATGG - Intergenic
1067960906 10:50848231-50848253 TTGTGTTAATGTAAAAATGAAGG - Intronic
1069655383 10:70083853-70083875 CTGTGGAATTGTGATAATGTTGG + Intronic
1070149936 10:73799394-73799416 CTGGGTGAGTGAGATACTGAGGG - Exonic
1070279168 10:75036432-75036454 CTGTGTGCATGTTAACATGAGGG + Intergenic
1070428082 10:76308738-76308760 CTGTCTGAATCTGAAAGTGACGG + Intronic
1071082572 10:81829983-81830005 ATCTGTGTATGTCATAATGACGG - Intergenic
1071724480 10:88183344-88183366 TTGTGTGAAAGTGAAAAAGAAGG - Intergenic
1071839383 10:89453390-89453412 ATGTCTGAATTTTATAATGAGGG - Intronic
1073190776 10:101649369-101649391 GTGTATGGATGTGATAATGGTGG - Intronic
1075228074 10:120647595-120647617 CTGTGCGAATCCGATATTGATGG - Intergenic
1075932833 10:126313907-126313929 CTGCTTAAATGAGATAATGAGGG + Intronic
1076138314 10:128060121-128060143 CTGTGTGAATGTGTGCATGTGGG - Intronic
1077936063 11:6786808-6786830 CTGTGTGTTTGTGCTAAAGATGG + Intergenic
1078609585 11:12808886-12808908 CTGTGAGAATGTGAGAATACAGG + Intronic
1079793029 11:24763077-24763099 ATGTGTGAATTTAGTAATGAAGG + Intronic
1079960358 11:26916139-26916161 ATGTGTGAATGTAAGAATAATGG + Intergenic
1080035204 11:27702259-27702281 CTGGGTGAGTGTTAAAATGAAGG + Intronic
1080455034 11:32410668-32410690 CTGTGTGACTTTTATAATCAAGG + Intronic
1085958706 11:81433581-81433603 TGGTGTGTATGTGATAATGCTGG - Intergenic
1087804819 11:102544446-102544468 TTGTGTCATTGTGATAATCATGG + Intergenic
1088010342 11:104993511-104993533 CTCTGTGAATCTGATAATCTAGG + Intergenic
1091541397 12:1465856-1465878 CTGTGAGAATGTGCTGATGCTGG + Intronic
1092953543 12:13529351-13529373 CTCTGTGAAAGGGATAATGTGGG - Intergenic
1094243691 12:28261077-28261099 CTGTCTGGATGTGACAGTGAAGG + Intronic
1095921859 12:47539831-47539853 CTGTGTTTATGTGAGACTGAGGG - Intergenic
1096574668 12:52545185-52545207 CTGAGGGAATGAGAGAATGAGGG - Intronic
1098814087 12:75135303-75135325 CTGTGTGAATGTGATAATGATGG + Intronic
1100091800 12:90982004-90982026 ATGTGTGAATTTGTAAATGATGG + Intronic
1100280126 12:93110607-93110629 AGGAGTGAATGAGATAATGAAGG - Intergenic
1100332526 12:93598074-93598096 CTGTGTGAAAATGATAATATAGG + Intergenic
1102871190 12:116415456-116415478 CTGTGTGTATGCGTGAATGAGGG + Intergenic
1104094612 12:125545614-125545636 CAGTGTGACTGTGATTAAGACGG + Intronic
1104917595 12:132273950-132273972 CACTGTGAATGTGAAAATGCTGG - Intronic
1105718949 13:23094867-23094889 CTGTGTCAATGTGATAACATAGG + Intergenic
1106318212 13:28613994-28614016 GTGTGTGAATGTGGTATTCAAGG + Intergenic
1114849088 14:26360855-26360877 CTGTGGGAATGAGGTAATGTGGG - Intergenic
1116426215 14:44795334-44795356 CTTTCTGAATGTGATTCTGAGGG - Intergenic
1116503356 14:45648142-45648164 CTGTGTCTATGTGTTAATTAAGG - Intergenic
1117270613 14:54139718-54139740 CTGTTGGAATGAGAGAATGATGG - Intergenic
1119470888 14:74898311-74898333 CTGTGTGAAAGTCAAAATGCAGG + Intronic
1119658384 14:76433594-76433616 CTGCCTGAATGTGTTCATGAAGG + Intronic
1121920864 14:97879900-97879922 CTTTGTGAAGGTCATCATGATGG - Intergenic
1124129930 15:26974425-26974447 TTGTGTGTATGTGATTATCAGGG + Intronic
1124870980 15:33542285-33542307 CTGTGTGAGTAGGATATTGATGG + Intronic
1125135951 15:36342835-36342857 CTGTGTGTATGTGTATATGAGGG - Intergenic
1126211026 15:46100362-46100384 CTTTGTGAATGTGATTGTGGAGG + Intergenic
1129088767 15:73126238-73126260 GTGTGTGTATGTGGTAATGATGG + Intronic
1129611986 15:77068102-77068124 CTGTGGGAATCTGATGATGATGG - Intronic
1130674482 15:85939791-85939813 ATGGGTGAATTTCATAATGATGG - Intergenic
1131451912 15:92548442-92548464 TTTTGGGAATGTGAAAATGATGG - Intergenic
1134105053 16:11479265-11479287 CTGTGTGTATGTTTTCATGAAGG + Intronic
1134556323 16:15168633-15168655 CTGTAGGAATCTGCTAATGAGGG - Intergenic
1134916905 16:18080339-18080361 CTGTAGGAATCTGCTAATGAGGG - Intergenic
1135162473 16:20109406-20109428 CTGTGGGAATGTGACTATGAGGG + Intergenic
1136036031 16:27541169-27541191 CTGTGTGAATGAGAGAATTAAGG + Intronic
1137320869 16:47380365-47380387 GTGTGTGAATCACATAATGAGGG - Intronic
1138796150 16:59971754-59971776 ATGAGTGAATGTGTTAATGAAGG + Intergenic
1140621542 16:76740154-76740176 GTGTGTGTGTGTGATAATAATGG + Intergenic
1141020806 16:80494488-80494510 CTCTTTGAATCTGATAATAATGG + Intergenic
1141284247 16:82656323-82656345 GTGTGTGTGTGTGTTAATGATGG + Intronic
1141932387 16:87214768-87214790 CTCTGTGAAGGTGATAAAGAAGG - Intronic
1142107574 16:88313631-88313653 CTGTGTGATTATGATAATGCTGG + Intergenic
1143196321 17:5078734-5078756 CTGTGTGCAGGTGGAAATGAAGG - Intronic
1143471067 17:7176325-7176347 GTGTGAGAGTGTGAGAATGAGGG - Intronic
1143471073 17:7176424-7176446 GTGTGAGAGTGTGAGAATGACGG - Intronic
1143973561 17:10813461-10813483 CTATGAGAATGTGATAAAGAGGG + Intergenic
1144310675 17:14011421-14011443 GTGTTTGAATGTGATAGGGAAGG - Intergenic
1146835693 17:36108770-36108792 CTGTGTCAATGGGAGCATGATGG - Intergenic
1146919704 17:36702533-36702555 CTGTGGGAAGGGGATGATGAGGG - Intergenic
1147350696 17:39840867-39840889 CAGTGTGAATGAGGTAAGGAGGG + Intronic
1147730816 17:42600457-42600479 TTTTTTGCATGTGATAATGATGG + Intronic
1148624715 17:49060429-49060451 GTGTGTGAGTGTGCTGATGATGG + Intergenic
1153093511 18:1374671-1374693 CTGTGTGAATTAGATAAAGGAGG + Intergenic
1153192663 18:2559481-2559503 CAGTTTGGATGTGGTAATGATGG + Intronic
1153516294 18:5905320-5905342 CTGTGTGAGGCTGATCATGATGG + Intergenic
1155323580 18:24643741-24643763 CTGTGAGATGATGATAATGATGG + Intergenic
1156159839 18:34346402-34346424 CTGTGTTAATGTCATAGTGATGG + Intergenic
1156968846 18:43130479-43130501 ATGAGTGAATATGACAATGAAGG - Intergenic
1157541896 18:48516633-48516655 CTATTTGAATGGGATAATGTGGG - Intergenic
1157898000 18:51486772-51486794 CTGTGTGAATGGGTTGCTGAAGG + Intergenic
1159249935 18:65862797-65862819 GTGTGTGACTGTGATGCTGACGG + Exonic
1159745170 18:72225153-72225175 CTCTGAGAAAGTGATGATGAGGG + Intergenic
1161745124 19:6053549-6053571 GTGGGTGATGGTGATAATGAGGG + Intronic
1162867635 19:13560843-13560865 CTGTGGGAAAGAGATGATGAGGG - Intronic
1163084909 19:14972593-14972615 GTGTGTGCAGGTGAGAATGAAGG + Intronic
1164067141 19:21725979-21726001 CTGTGCGAATGTAATAAAGTTGG - Exonic
1164944574 19:32282643-32282665 ATGGGTGAATTTGATAGTGATGG + Intergenic
1165075343 19:33277217-33277239 GTGTGTGAATGTGTGAATCAGGG - Intergenic
1168627839 19:57933087-57933109 GTGTGTCAATGTCATAATGGAGG + Intronic
925110728 2:1334302-1334324 CGGTGTGAATGTGATAAAAAGGG + Intronic
925988251 2:9233202-9233224 CTGTGTGACAATTATAATGAAGG + Intronic
926837580 2:17041253-17041275 CTGAGTGAAAGTTATAAGGAGGG + Intergenic
927319475 2:21725760-21725782 CAGTGAGTATGAGATAATGAAGG + Intergenic
928746107 2:34417876-34417898 CTGTGAGTTTGTGACAATGAGGG - Intergenic
929055265 2:37871183-37871205 CTGTGTGAAGGTGATAAACCGGG - Intergenic
931319711 2:61164194-61164216 ATGTGAAAATGTGATCATGATGG + Intronic
934189306 2:89771605-89771627 CAGAGTGAAAGGGATAATGAAGG + Intergenic
934765277 2:96876953-96876975 TTGTGTGAATGTCAGAATCAGGG - Intronic
935344667 2:102095212-102095234 CTGTGTGTATGTGATAGTGATGG + Intronic
935370095 2:102336338-102336360 TTGGGTGAGTGTGAGAATGAAGG + Intronic
935606361 2:104975526-104975548 CAGTGTGGACGTGGTAATGAGGG + Intergenic
936743641 2:115546670-115546692 CTGAGTGCATGTGATATTGCTGG - Intronic
937904137 2:127043988-127044010 ATGTGTGAATGTGAGTGTGAAGG - Intergenic
937904149 2:127044263-127044285 GTGTGTGAATGTGAGTGTGAAGG - Intergenic
939154845 2:138513048-138513070 CAGTCTGAGTGTGGTAATGATGG + Intronic
939173287 2:138720980-138721002 GTGTGTAAATGTGAAACTGAAGG + Intronic
939996307 2:148923671-148923693 CTATTTGTTTGTGATAATGAAGG - Intronic
941695502 2:168546874-168546896 CTGTGTGAATGAGGTGCTGAAGG - Intronic
942151475 2:173080272-173080294 CTGTATCAATGTGGTAAAGAAGG + Intronic
942153899 2:173107199-173107221 CTGTCTGGAGGTGGTAATGAGGG + Intronic
943590373 2:189788947-189788969 TTGTGTGAATGTTATGATGATGG + Intronic
944643978 2:201759729-201759751 CTGTCAGAATGTGAACATGAAGG - Intronic
944896963 2:204175052-204175074 CTGTTCGAATGAGACAATGATGG - Intergenic
948126100 2:235565542-235565564 GTGTGTGAATGTTATTATGAAGG + Intronic
1168933791 20:1645873-1645895 CTGTGTGATGCTGATAATCATGG - Intronic
1169523659 20:6400099-6400121 GTGTGTGTATGTGAAATTGAAGG + Intergenic
1169746968 20:8952507-8952529 CTGGGGGAATAGGATAATGAGGG - Intronic
1170089321 20:12573171-12573193 TAGTATGAATGTGATAATGCGGG - Intergenic
1171085022 20:22230534-22230556 CAGTGTGTATGGGAGAATGAAGG + Intergenic
1173855491 20:46247891-46247913 CTGGGTGAAGGTGATAGAGAAGG + Intronic
1175533042 20:59687317-59687339 CGGTGTGATGGTGGTAATGAGGG + Intronic
1176039552 20:63057742-63057764 GTGTGTGAATGAGTGAATGAAGG - Intergenic
1176245918 20:64096767-64096789 GATGGTGAATGTGATAATGAAGG - Intronic
1177569192 21:22864398-22864420 CTGTGTGAATGTCTTTAAGATGG - Intergenic
1178550754 21:33537014-33537036 CTGCCTGAATGTGATTAGGATGG + Intronic
1179078056 21:38142689-38142711 TTGTGAGAATCTGATAAAGAAGG + Intronic
1179771429 21:43620741-43620763 CTGTTTGATGGTGATGATGATGG - Intronic
1180534284 22:16383136-16383158 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1181472394 22:23148754-23148776 CTGGAAGACTGTGATAATGAAGG - Intronic
1182455309 22:30446633-30446655 CTGCAGGAAGGTGATAATGATGG - Intergenic
1182733787 22:32516157-32516179 CTGTGTGTGTGAGAAAATGAGGG + Intronic
1183031070 22:35104974-35104996 GGGTGTGAATGTGGTTATGAAGG - Intergenic
1184934102 22:47706471-47706493 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
1203238079 22_KI270732v1_random:26723-26745 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1203315359 22_KI270737v1_random:2660-2682 CAGAGTGAAAGGGATAATGAAGG + Intergenic
949448110 3:4156941-4156963 CTGTGAAAATGTTTTAATGATGG - Intronic
950622271 3:14215404-14215426 CTGTGAAAATGGGATAATAATGG + Intergenic
950947196 3:16961503-16961525 CTGAGGGAAAGTGCTAATGAGGG + Intronic
952766353 3:36957310-36957332 CTTTGTGGAGGTGATAATGAAGG - Intergenic
955808660 3:62762960-62762982 GTGTGTGAATGTGAAAGAGAGGG + Intronic
956054230 3:65281379-65281401 CACTGTGAAAGTGAAAATGATGG - Intergenic
956769187 3:72510086-72510108 CTGTGTGAATGTTTTAATTAGGG + Intergenic
957262068 3:77914910-77914932 CATTGTGAATGTGCTAATTACGG + Intergenic
957600331 3:82325720-82325742 ATGTGTCAATGTGATTGTGAAGG - Intergenic
958988850 3:100817358-100817380 CAATGTGATTATGATAATGATGG + Intronic
959525853 3:107375692-107375714 CTCTGTAAGTGTGACAATGAGGG + Intergenic
959544838 3:107582669-107582691 CTGTGTTAATGTTGTATTGATGG + Intronic
961618236 3:128200855-128200877 TTGTGTGAATGTGACACTGTAGG + Intronic
962526173 3:136239566-136239588 CTGAGTGAATGAGAGAAAGAGGG - Intergenic
963240340 3:142996758-142996780 GTGTGTGAGTGTGATAAAGGAGG - Intronic
964110441 3:153081979-153082001 GTGTGTGTGTGTGAGAATGATGG - Intergenic
964724424 3:159799598-159799620 ATGTGTAAGTGTGATAATAAGGG + Intronic
965186393 3:165470218-165470240 ATGTGTCAAGATGATAATGATGG + Intergenic
965548914 3:169944542-169944564 CTTTGTCCATGTGTTAATGAGGG - Intergenic
965983186 3:174718447-174718469 CTGTGTCAATAAAATAATGAAGG - Intronic
966506356 3:180706527-180706549 CTGTGTCTATGTGTTAATGGTGG - Intronic
968614878 4:1573137-1573159 GAGTGTGAATGTGAGAATGTGGG - Intergenic
968889832 4:3362623-3362645 GTGTGTGAATGTGAGAGTGAGGG + Intronic
968889857 4:3362793-3362815 GTGTGTGAATATGAGAGTGAGGG + Intronic
970187519 4:13475686-13475708 GTGTGTGTCTGTGGTAATGATGG - Intronic
971103079 4:23490693-23490715 GTTTGTGAATCAGATAATGATGG - Intergenic
971292059 4:25352178-25352200 CTGTGTGAATGTGTTGATTCCGG + Intronic
971616242 4:28793812-28793834 ATGTATGTATGTGATAATAAAGG + Intergenic
973706662 4:53588007-53588029 CTATCTGGATGTAATAATGATGG - Intronic
975124501 4:70766663-70766685 CTGTGGGATGTTGATAATGAGGG - Intronic
975288149 4:72644897-72644919 CAGTGTGAATGGGGTTATGAAGG - Intergenic
975671137 4:76781920-76781942 CTTTGTGGATGTGATAATTTTGG + Exonic
977965701 4:103144986-103145008 TAGTGTTAAGGTGATAATGACGG - Intronic
978071218 4:104472756-104472778 CTGTGTGTATGTTATCCTGACGG - Intronic
978722292 4:111924977-111924999 CTGGGTGACTGTAAGAATGAGGG + Intergenic
979186379 4:117799732-117799754 CTGAATGAAAGTGATAATAATGG - Intergenic
979529805 4:121757795-121757817 CTGTGGGAATGACATAAGGATGG + Intergenic
979857797 4:125655847-125655869 GTGTGTGTCTGTGATAATGGTGG + Intergenic
979862110 4:125707186-125707208 CTGTGTCCTTGTGATAAGGAAGG - Intergenic
980530602 4:134047534-134047556 CTGTGACAGTGTGTTAATGAGGG - Intergenic
983002664 4:162437326-162437348 CTGTGTGAACATCAAAATGAAGG - Intergenic
983976122 4:173936403-173936425 CTGTGGGAAAGTGACAATGGAGG - Intergenic
984336995 4:178404934-178404956 CTATGTGAAAATGATAAGGATGG + Intergenic
985238445 4:187902505-187902527 CTGGGTGAATGAGGGAATGAAGG + Intergenic
986589824 5:9357033-9357055 CTGTGTGAATGGGCTCAGGAAGG - Intronic
987702713 5:21422378-21422400 ATGTGTGAATGACATAGTGAAGG + Intergenic
988820928 5:34884509-34884531 GTGTGTGTATGTGATCATTAGGG - Intronic
992657555 5:78925402-78925424 CAGTGGGAATGTGATAATGAAGG + Intronic
994027089 5:95097259-95097281 ATAGGTTAATGTGATAATGAGGG + Intronic
994776188 5:104037462-104037484 CTGTGGAAATGTGGTAAGGATGG - Intergenic
995870796 5:116741269-116741291 CAGTGTGTGTGTGATAGTGATGG + Intergenic
998387659 5:141767129-141767151 ATGTGTGAATGGGTGAATGAAGG + Intergenic
998633570 5:143927926-143927948 TTTTGTGGATGTGAGAATGATGG + Intergenic
999596257 5:153208153-153208175 CTGTGTGTGTGTGCTAATGATGG + Intergenic
1000383373 5:160649039-160649061 TTGTGTGTGTGTGATAAAGAGGG - Intronic
1000926663 5:167202646-167202668 CTGTGTGACTGGGAGGATGATGG - Intergenic
1003729023 6:8799620-8799642 GTGTGTGTATGTGAGCATGAGGG + Intergenic
1004955647 6:20724976-20724998 CTTGGCGAATGTGATAATTAGGG + Intronic
1006251339 6:32788975-32788997 CTGTGTTAATTTGCTAAGGATGG - Intergenic
1006961811 6:37939491-37939513 ATCTGTGAATGTGATAATTTTGG - Intronic
1007694175 6:43721410-43721432 ATGTGAGAATGTGAGAATGGTGG - Intergenic
1009302119 6:62037326-62037348 TTGAGTGAATCTGATATTGACGG + Intronic
1009422023 6:63474099-63474121 ATGTGTGAATGTCATAATATGGG - Intergenic
1009728875 6:67572919-67572941 TTGAGTGAATTTGAGAATGAAGG - Intergenic
1010536751 6:77040125-77040147 CTATGTAAGGGTGATAATGAAGG - Intergenic
1013587044 6:111588554-111588576 CTGACTCAATGTTATAATGAAGG - Intronic
1015416931 6:132959889-132959911 GTGTGTGAGTGTGAGTATGAAGG - Intergenic
1015430811 6:133128746-133128768 CTGTGTAAGTTTGATAATGAGGG - Intergenic
1016045912 6:139480224-139480246 CTGTGAGAATGAGATTATGGTGG - Intergenic
1016071606 6:139746116-139746138 CTGTGTGACTGAAAGAATGAAGG + Intergenic
1016331953 6:142962255-142962277 CTGTTTGGATGGGATAATGGTGG + Intergenic
1016698992 6:147032801-147032823 CTGTGTGATTCTGACCATGATGG + Intergenic
1018633464 6:165840247-165840269 CTGTGTGAGGGAGATAAGGATGG - Intronic
1018847198 6:167563817-167563839 ATGTGTGAATGAGGGAATGAGGG - Intergenic
1018847200 6:167563825-167563847 ATGAGTGAATGTGTGAATGAGGG - Intergenic
1019069313 6:169329353-169329375 ATGTGTAAATGTGAGAATGTGGG - Intergenic
1019138045 6:169923737-169923759 ATGAGTGATGGTGATAATGATGG - Intergenic
1019856516 7:3613847-3613869 CTGTGTTAGTTTGCTAATGATGG - Intronic
1019910604 7:4098481-4098503 CTGGGTGAATGGGCGAATGAAGG - Intronic
1020395960 7:7717854-7717876 ATGTGTCAATTTGATAATTATGG - Intronic
1022794770 7:33723079-33723101 CTGATTTAATGTGATAATCAGGG - Intergenic
1023024778 7:36040618-36040640 CTGTGAGAATTTGACAAAGAGGG + Intergenic
1023813402 7:43929766-43929788 CCTTGTGAATGTGAAAATGTAGG - Intronic
1024229291 7:47351899-47351921 CTGTGTGCATGTGAGTATGTGGG - Intronic
1024630432 7:51242843-51242865 CTGTGCGGAGGTGATAATGTTGG - Intronic
1024804742 7:53125184-53125206 CAGAGTGAAAGGGATAATGAAGG + Intergenic
1025875710 7:65478326-65478348 CTGTTTTAATGTGAAAAAGAAGG + Intergenic
1027955376 7:84872594-84872616 CTCTAAGAATGTGATAAGGATGG - Intergenic
1030456375 7:109779849-109779871 CTGGGTGGAGGTTATAATGAAGG - Intergenic
1030745817 7:113164935-113164957 CTGGGAGAATGTTAAAATGATGG + Intergenic
1031960076 7:127981206-127981228 TTCTGTGAATTTGTTAATGAAGG + Intronic
1033006727 7:137573239-137573261 TTGTTTGAATCAGATAATGATGG - Intronic
1034969440 7:155410004-155410026 GTGTGTGAATGTGTTTGTGAGGG + Intergenic
1035909207 8:3547113-3547135 CTGTGTGAATGGCAGCATGAGGG - Intronic
1036402047 8:8417781-8417803 AAGCGAGAATGTGATAATGAAGG - Intergenic
1036469283 8:9036902-9036924 CTATGTGACTGTGATAATCATGG - Intronic
1036947400 8:13107118-13107140 CAGTGTGAATGTAAAAATGCTGG + Intronic
1039854754 8:41402638-41402660 CTTTGCAAATGTGATAATAAGGG - Intergenic
1040609391 8:48967608-48967630 CTGTGTGTTTATGGTAATGAGGG + Intergenic
1040727197 8:50395924-50395946 TTGTGTGAATGAGATACTTATGG + Intronic
1041853697 8:62423511-62423533 TTGTGTTAATTTGAGAATGATGG - Intronic
1043106361 8:76117107-76117129 GTGAGTGAATGTGAAGATGAAGG + Intergenic
1046413308 8:113876928-113876950 TTGTGTGTATGTTATAAGGAAGG + Intergenic
1046829584 8:118729862-118729884 CTGAGTGCATGAGATAAGGAAGG - Intergenic
1048775909 8:137945956-137945978 CTGAGTGAATGAAGTAATGATGG - Intergenic
1049258060 8:141624420-141624442 CTGTGTGAATGAGTGAGTGAGGG + Intergenic
1049398626 8:142414111-142414133 CTGTGTGAATGTGCATGTGAGGG - Intergenic
1055312388 9:74996152-74996174 ATGTGGGATGGTGATAATGAGGG + Intronic
1056266553 9:84902359-84902381 CTGTAAGAATGTGAGAATTAGGG + Intronic
1057848973 9:98549832-98549854 CTGAGTGCTTCTGATAATGATGG + Intronic
1058295606 9:103303239-103303261 CTGTGTCAATTAGATGATGAGGG - Intergenic
1058351746 9:104033393-104033415 ATGTTTGAATGAGATAATGAGGG + Intergenic
1058817365 9:108696752-108696774 CTGTGTGTATGTGAATACGATGG + Intergenic
1061351319 9:130067066-130067088 CTGGGAGAATGTGACACTGAGGG + Intronic
1203616248 Un_KI270749v1:68584-68606 CAGAGTGAAAGGGATAATGAAGG - Intergenic
1185891122 X:3822870-3822892 CTGTGTGTGTGTGGTCATGAGGG + Intronic
1187520845 X:20012676-20012698 CTGTGTGAAGGTGATTATATGGG - Intronic
1187715477 X:22098158-22098180 CTGTGTGTATGTGAGAGTGAGGG + Intronic
1188547628 X:31326647-31326669 GTGTGTGTATGTGATTATGATGG - Intronic
1189706411 X:43763149-43763171 CTCTGTGAAGGTCATAATCAAGG - Intergenic
1190407621 X:50103311-50103333 CTGTGTGTATGTGGAAATGAGGG + Intergenic
1191203934 X:57814858-57814880 CTTTGTGAATCTGATAATTATGG + Intergenic
1192615834 X:72621209-72621231 GTGTGTGCATGTGATAGTAATGG + Intronic
1193027485 X:76860101-76860123 ATGTTTAAATTTGATAATGAAGG + Intergenic
1194154956 X:90376234-90376256 TTCTGTGCATGTGATAGTGAGGG - Intergenic
1200501304 Y:3953120-3953142 TTCTGTGCATGTGATAGTGAGGG - Intergenic
1201971968 Y:19807613-19807635 ATGTGTAAATGTGTTAATGTTGG + Intergenic