ID: 1098817543

View in Genome Browser
Species Human (GRCh38)
Location 12:75186506-75186528
Sequence TAACCTTTTTTTACAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 343}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098817543_1098817544 18 Left 1098817543 12:75186506-75186528 CCTTCTGTTGTAAAAAAAGGTTA 0: 1
1: 0
2: 1
3: 27
4: 343
Right 1098817544 12:75186547-75186569 TACTATGAAACAATTATTCAAGG 0: 1
1: 0
2: 3
3: 38
4: 359
1098817543_1098817545 19 Left 1098817543 12:75186506-75186528 CCTTCTGTTGTAAAAAAAGGTTA 0: 1
1: 0
2: 1
3: 27
4: 343
Right 1098817545 12:75186548-75186570 ACTATGAAACAATTATTCAAGGG 0: 1
1: 0
2: 2
3: 28
4: 355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098817543 Original CRISPR TAACCTTTTTTTACAACAGA AGG (reversed) Intronic
903272878 1:22202643-22202665 TCACTTTTTTTTTTAACAGAAGG + Intergenic
904122492 1:28209538-28209560 TAAACTTTTTTTAAAATAGGAGG - Intronic
905110814 1:35593172-35593194 TAATTTTTTTTTAGTACAGATGG - Intronic
905132054 1:35768983-35769005 TAAACTTTATTTACAAAAGCGGG - Intronic
905324583 1:37141939-37141961 TATACTTTTTTTAGTACAGACGG - Intergenic
905833597 1:41096250-41096272 TAACCTTTTTAAAAAATAGATGG + Intronic
907016655 1:51022114-51022136 TAATCTACTTTGACAACAGATGG - Intergenic
907020713 1:51064385-51064407 TAACTTTTTTTTTTAAGAGACGG - Intergenic
907323418 1:53619807-53619829 TAATCTTGTTTTACATAAGAGGG + Intronic
907804407 1:57803906-57803928 TACCTCTTTTTTACAACAAATGG + Intronic
908332866 1:63087948-63087970 TAACCTTTTTTCAAAGCCGAAGG - Intergenic
908736544 1:67282821-67282843 TAACATTTTTTTAAAAAAGATGG + Intergenic
909688719 1:78380300-78380322 AAAACTTATTTTACAGCAGATGG + Intronic
909972155 1:82003908-82003930 GATCCTTATTTTACAAAAGAAGG + Intergenic
910278952 1:85477253-85477275 TAACCTTGTTTTAAAGCTGAGGG + Intronic
910672762 1:89789678-89789700 TAACTTTTTTTTAAAAGACAGGG + Intronic
910812500 1:91252758-91252780 TATCCTTATTTTTCAACACAGGG + Intergenic
911067499 1:93803664-93803686 TAACCTTTTGGGACCACAGATGG - Intronic
911157121 1:94647692-94647714 CAACCTTGTTTTACAGAAGAGGG + Intergenic
911352654 1:96773305-96773327 AAAGCATTTTTTTCAACAGAAGG - Intronic
914223172 1:145698621-145698643 TAACATATTTTTAAAACATAAGG + Intronic
914257313 1:145971011-145971033 TATACTTTTTTTAGTACAGAGGG - Intronic
914981740 1:152420591-152420613 TAACCTTTGTTTACACCAAATGG + Intergenic
917369674 1:174278230-174278252 TAAAATATTTTTACTACAGACGG - Intronic
917882978 1:179357584-179357606 TAACATTTTATTTCAACAGAGGG - Exonic
918019557 1:180673270-180673292 TACCCTATTTTTACAAAAAAAGG + Intronic
918174874 1:182035052-182035074 CTAGCTTTTTCTACAACAGAGGG - Intergenic
918608968 1:186464824-186464846 TAACTTTTTTTTTTAAGAGAAGG + Intergenic
919263394 1:195228855-195228877 TATACTTTTTTCAGAACAGAAGG - Intergenic
919704117 1:200659989-200660011 TTACCTTTTTTTAAACAAGAAGG + Intronic
920093624 1:203471764-203471786 TAACCTTTTTTTAAAAAAAGAGG + Intergenic
921087270 1:211806674-211806696 TAAAATTTTTTTAAAAAAGAAGG + Intronic
923344247 1:233035712-233035734 TAACCTTATGTGACCACAGAAGG - Intronic
1063712564 10:8493783-8493805 TAAAATTTTTTTAAAAAAGAAGG - Intergenic
1065160873 10:22920030-22920052 TAACTTTTCTTTACAATAGTAGG + Intergenic
1066076085 10:31878644-31878666 AAAACTTTATTTACAAAAGAAGG - Intronic
1066553181 10:36581990-36582012 AAACATTTTTTTAAAAAAGATGG - Intergenic
1067316112 10:45164728-45164750 AAATCTTTTTTAAAAACAGAGGG + Intergenic
1067762108 10:49056294-49056316 TAACATTTTTTTACACTAGCTGG + Intronic
1068208854 10:53893949-53893971 TAAACTTTTTTTAAAACCCAGGG + Intronic
1068579995 10:58729180-58729202 ACACCTTTTTTTCCAACAGAAGG + Intronic
1069110803 10:64443759-64443781 TAAACTTTATTTACAAAAGCAGG + Intergenic
1071394808 10:85212783-85212805 AAACCTTATTTGAAAACAGATGG + Intergenic
1071697715 10:87895136-87895158 TAAACTTTTTTTTTAAGAGATGG - Intronic
1073234471 10:102002172-102002194 TAAGCTTTTTCCACAACAGAGGG + Intronic
1073455095 10:103631945-103631967 TAACATTTTTTTTTAAGAGATGG - Intronic
1073467030 10:103700262-103700284 TAACCCCCTTTTACAACCGAAGG - Intronic
1073686671 10:105761969-105761991 TAAACTTTTATGAAAACAGATGG + Intergenic
1074151695 10:110764984-110765006 TAATTTTTTTTTAAAACGGAGGG - Intronic
1074583279 10:114741617-114741639 TAACCATTTTTTCTAACATATGG - Intergenic
1076075014 10:127526648-127526670 TTACCTTCTTTGCCAACAGATGG + Intergenic
1077928276 11:6704413-6704435 TAATCTTTTTTTTGTACAGATGG + Intergenic
1078801757 11:14652219-14652241 TAACAGTTTTTTTCAACAAATGG - Intronic
1079271197 11:18987455-18987477 GAAACTTTATTTATAACAGAGGG - Intergenic
1082106415 11:48226535-48226557 TAACATTTTTTTAAAAAAAAAGG - Intergenic
1082728343 11:56764479-56764501 TAACCTTCTTTTACATTTGAGGG - Intergenic
1084906319 11:72350662-72350684 AAACTGTTTTATACAACAGAGGG + Intronic
1085098775 11:73782730-73782752 TAACTTTTTTTTAGTAGAGACGG + Intergenic
1085660007 11:78355345-78355367 GAATCTTTTTTGATAACAGAAGG - Intronic
1086534163 11:87823661-87823683 TAAAGTTTTTTTTCAACAAATGG + Intergenic
1086932776 11:92710603-92710625 TTAGCATTTTTTACAACAGAAGG + Intronic
1087010907 11:93513194-93513216 TATCCTTATTTTACAAAAGAGGG - Intronic
1087621212 11:100544692-100544714 TAACATTTTTTAACTGCAGAAGG + Intergenic
1087991726 11:104751598-104751620 TCACCTTCTTTTAGAGCAGATGG + Intergenic
1092096088 12:5843039-5843061 TAACATTTGTTTTCAATAGAGGG - Intronic
1094172583 12:27509277-27509299 AAACATTTTTATGCAACAGAAGG + Intergenic
1095093195 12:38126466-38126488 TAAGCTAATTTTACAAAAGAAGG - Intergenic
1095886835 12:47197280-47197302 TGACTTTTTTTTACAAGCGAGGG - Intronic
1096766813 12:53897837-53897859 TAATATTTTTTTACACCAGCAGG - Intergenic
1097355897 12:58601461-58601483 CAACCTGTCTTTACAAGAGATGG - Intronic
1097992003 12:65845636-65845658 TAAACATTTTTGACAAAAGATGG + Intronic
1098817543 12:75186506-75186528 TAACCTTTTTTTACAACAGAAGG - Intronic
1100759321 12:97789323-97789345 TAACCAGTTTTCCCAACAGATGG + Intergenic
1101486766 12:105171933-105171955 TTCCCTTGTTTTACAACTGATGG + Intergenic
1101565178 12:105898146-105898168 GAAACTTTATTTATAACAGAAGG - Intergenic
1101829870 12:108248847-108248869 CAATCTTTCTTTAGAACAGAAGG - Exonic
1103421734 12:120790601-120790623 TAAGGTTTCTTTACAAGAGAAGG - Intronic
1103699164 12:122839560-122839582 TAACATTTATTGACAACTGAGGG + Intronic
1105881188 13:24607755-24607777 TAACTATTTTTAAAAACAGAAGG + Intergenic
1107167721 13:37302025-37302047 TAACATTTTTTAAAAATAGATGG - Intergenic
1107484400 13:40812705-40812727 TAACTATTTTTTAAAATAGAGGG - Intergenic
1107700004 13:43037544-43037566 TAACATGTTTTAACATCAGAAGG - Intronic
1108785425 13:53895244-53895266 TAACCCTTTATTATAACATATGG - Intergenic
1110118009 13:71844062-71844084 TATCCTTATTTTCCCACAGAAGG + Intronic
1110398085 13:75055832-75055854 TAACTTTTTCTTACAAATGAGGG + Intergenic
1110959932 13:81608791-81608813 TTACCATTTTTTAAAATAGATGG - Intergenic
1112904942 13:104405796-104405818 CTACCTTTTTTTCCAAGAGAAGG + Intergenic
1113256013 13:108506068-108506090 TAACATGTTTTAAAAACAGAAGG + Intergenic
1115102318 14:29717391-29717413 TAATGTTATTTTACAGCAGATGG + Intronic
1116975709 14:51113764-51113786 TAACTTTTTTTTAAGAGAGATGG + Intergenic
1116986807 14:51228742-51228764 TAAGCTTTTGTAAAAACAGATGG + Intergenic
1121036481 14:90708292-90708314 TAACATTTTCTTCCAATAGAAGG - Intronic
1121038435 14:90725893-90725915 TACCCTTTGTTTACAAAAGATGG + Intronic
1121852500 14:97235147-97235169 TAACCCTTTTTGCCAAAAGAAGG - Intergenic
1124460231 15:29883174-29883196 TAACCTTCTTTGACAATAGTTGG - Intronic
1125974736 15:43940994-43941016 AAACATTTTTTTAAAACATAGGG - Intronic
1126967244 15:54068429-54068451 TAAACTTTATTTACAAAAGCAGG - Intronic
1127276776 15:57453103-57453125 TAAACTTTTTTTTCATCAGGTGG + Intronic
1127597162 15:60497178-60497200 TGACCTCTGTTTACAACAGGAGG - Intronic
1127964388 15:63912912-63912934 AAACCTTATTTTACAAAAGGGGG - Intronic
1128011662 15:64302902-64302924 TCACTGTTTTTTCCAACAGATGG + Intronic
1128652281 15:69426711-69426733 TAACTTTTTTTTTCAAGACAGGG - Intronic
1129577532 15:76766506-76766528 TAACTTTTTTTTAATAGAGACGG + Intronic
1130214721 15:81957395-81957417 TAAAATTTTTTTAAAAAAGAAGG + Intergenic
1130973058 15:88749727-88749749 TAGCCTTTTCTTAGAAAAGAGGG - Intergenic
1131835165 15:96383244-96383266 TAACTTTTTTTTTCAAGATAGGG - Intergenic
1131953440 15:97706063-97706085 TAATCTTGTTTTTCTACAGAGGG - Intergenic
1132084616 15:98897458-98897480 TGACCTTTATTTGCAATAGATGG + Intronic
1134205089 16:12231021-12231043 TAATATTTTTTTATTACAGATGG + Intronic
1137011814 16:35328903-35328925 TAAACTTTTTGGACATCAGAGGG - Intergenic
1137016176 16:35377698-35377720 TAAACTTTTTGGACATCAGAGGG - Intergenic
1143799154 17:9363893-9363915 AAACCTTTATTTATAATAGAAGG - Intronic
1143996484 17:11011050-11011072 TAACCCTTTTTTAAAACACTTGG - Intergenic
1144699826 17:17329803-17329825 TAATTTTTTTTTAGTACAGATGG - Intronic
1146474478 17:33151996-33152018 TATCCCTTTTTTGCAACAAAAGG - Intronic
1148225017 17:45893356-45893378 TAACTTTATTTTTAAACAGAGGG - Intergenic
1149120721 17:53160608-53160630 TGACCTTGTTTTACCACAGAAGG + Intergenic
1149129433 17:53279864-53279886 TAACCTTTCTTTAGAAGAGTGGG - Intergenic
1149473582 17:56940078-56940100 TTACCTTTTTTGACACTAGATGG - Intronic
1150938156 17:69660029-69660051 TGACTTTTTTTGACATCAGAGGG - Intergenic
1151883265 17:76907349-76907371 AAAACTTTTTTTACAAAAGCAGG - Intronic
1153915998 18:9744883-9744905 TAACCCAATTTTACAACATAGGG + Intronic
1154481491 18:14830879-14830901 CAATCTTTTTTAAAAACAGAGGG + Intronic
1155683969 18:28524078-28524100 TAACTTTTTTTTAAAAAAGAGGG - Intergenic
1155846502 18:30714462-30714484 TAACTTGTTTTTAAAACAAAAGG + Intergenic
1156128810 18:33942240-33942262 TAAAGTATTTTTACAACAAATGG - Intronic
1156394664 18:36688570-36688592 TACCTGTTTTTTACATCAGAGGG + Intronic
1156660800 18:39344137-39344159 TAAACTTTTCTTAGAAAAGAAGG - Intergenic
1156998857 18:43499790-43499812 AAACATGTTTTTACAAAAGAAGG - Intergenic
1157458413 18:47860240-47860262 AAACCTTTTCCTACAAGAGATGG + Intronic
1158167718 18:54559171-54559193 TAACATTTTGCAACAACAGATGG + Intergenic
1159385146 18:67714052-67714074 CAACCTTTTTTTAGAAAAGTAGG - Intergenic
1161005412 19:1933375-1933397 TGACCTGTTTTAGCAACAGAAGG - Intergenic
1161862375 19:6807701-6807723 TAACTTTTTTTTAAAAGACAGGG - Intronic
1164568143 19:29345581-29345603 TAACCTAATTTTACAACCTAAGG + Intergenic
1168712298 19:58508630-58508652 TAAAATTTTTTTTTAACAGATGG + Intronic
926032391 2:9603443-9603465 TAATTTTTTTTTAGAAGAGACGG + Intronic
928794660 2:35003065-35003087 TAACCTTTCTCTTTAACAGATGG + Intergenic
928937761 2:36698098-36698120 AAAGCTTTTTGTACAAAAGAGGG - Intronic
929369432 2:41204418-41204440 TAAACTTTTCTGAGAACAGAGGG + Intergenic
931237486 2:60423771-60423793 CATCCCTTTTTTACAGCAGAGGG - Intergenic
932502290 2:72193892-72193914 AAAACTTTATTTACAACAGGTGG - Intronic
932844518 2:75121730-75121752 TAAGCATTTTTTAAAAGAGAAGG + Intronic
933690710 2:85177362-85177384 TAAAATTTTTTTAAAACATATGG - Intronic
933701943 2:85261718-85261740 TAATTTTTTTTTTTAACAGATGG - Intronic
934235375 2:90227486-90227508 GAATGTTTTTTTCCAACAGAGGG + Intergenic
935092401 2:99908201-99908223 TAACCTTTTTTTGGAATAGGTGG + Intronic
935417102 2:102830453-102830475 TAAGCTTTATTTACAACACTGGG + Intronic
935666997 2:105521387-105521409 TAATCTGTTTTTACACCAGATGG - Intergenic
936128117 2:109809641-109809663 TAAACTTTTTCTACAAAAGGAGG - Intronic
936216580 2:110561844-110561866 TAAACTTTTTCTACAAAAGGAGG + Intronic
936425719 2:112416425-112416447 TAAACTTTTTCTACAAAAGGAGG + Intronic
936755093 2:115698856-115698878 CAACCTAATTTTACAACTGAAGG + Intronic
938469913 2:131549873-131549895 TAACAGTGTATTACAACAGATGG + Intergenic
938942202 2:136179122-136179144 TAACCTTCTTTTACGATAGCTGG + Intergenic
939171939 2:138706242-138706264 TATCCTTATTTTACAGCTGAGGG + Intronic
939554024 2:143652338-143652360 AAAGCTTTATTTACAAAAGAAGG + Intronic
939806641 2:146781907-146781929 TAACCTTTTTAAACTATAGAGGG - Intergenic
940567983 2:155392909-155392931 TAACATTTTTTTCATACAGATGG + Intergenic
941082913 2:161082512-161082534 TGACCTTTTTTAAAAACAGGAGG + Intergenic
941090070 2:161164765-161164787 TAACCTTTTTTTAAAGTATATGG + Intronic
941840261 2:170075191-170075213 TACCCTTTTTTTAAAAAAAAAGG + Intronic
942582691 2:177436791-177436813 AAATCTTCATTTACAACAGAAGG - Exonic
942964993 2:181881399-181881421 GAACATTTTTTTACATCACATGG - Intergenic
942966793 2:181904226-181904248 TAACCTTTTTTGCCAGTAGAGGG - Intronic
943808733 2:192157157-192157179 TAAAATTTCTTTAGAACAGAAGG + Intronic
943851238 2:192725172-192725194 TAACATCTATTTCCAACAGAAGG + Intergenic
943977358 2:194501340-194501362 CAATTATTTTTTACAACAGAGGG - Intergenic
944318766 2:198311704-198311726 TATCCTTTTCTTTCACCAGATGG - Intronic
945799494 2:214409513-214409535 TAAATTTTTTTTACATAAGATGG - Intronic
946516654 2:220419263-220419285 TCACCTTTTGTTAAACCAGAAGG + Intergenic
947040012 2:225906912-225906934 TGAACTTCTTTTACAACAAATGG - Intergenic
947227436 2:227853747-227853769 TAACCTCATTTTACAGGAGAGGG + Intergenic
948131802 2:235606507-235606529 GAACCTTTTTTTAAAAAAGTGGG + Intronic
1169485598 20:6028952-6028974 TAACATTTTTTAACCACAGTAGG + Intronic
1176799113 21:13405725-13405747 CAATCTTTTTTAAAAACAGAGGG - Intergenic
1177065416 21:16427545-16427567 TATACTTTTTTTAATACAGAAGG + Intergenic
1177844887 21:26278027-26278049 TAACCCCTTTTGACCACAGATGG + Intergenic
1177900016 21:26903503-26903525 TAACCTTTTTTCACTATAAAAGG - Intergenic
1178224692 21:30701709-30701731 TAACTTTGTTTTACTACAGGTGG - Intergenic
1179589095 21:42393813-42393835 AAAACTTTATTTACAAAAGAAGG + Intronic
1179619290 21:42602057-42602079 TAAATCTTTTTTACAAGAGAGGG - Intergenic
1180567491 22:16686148-16686170 CAACCTAATTTTACAACATAAGG + Intergenic
1182438723 22:30348495-30348517 TAAATTTTTTTTAAGACAGATGG + Intronic
1182734382 22:32520895-32520917 TGACCTTATTTTACAAATGAGGG - Intronic
1183572719 22:38666249-38666271 TAACCTTTTTTTGGTAGAGACGG + Intronic
1185263954 22:49888050-49888072 TAAAATTTTTTTAGAAGAGATGG + Exonic
949639182 3:6015582-6015604 AAACATCTTTTTACAAAAGAAGG - Intergenic
950615742 3:14156573-14156595 TAACTTGTTCTGACAACAGATGG + Intronic
951402595 3:22251886-22251908 AAACCTTATTTTACAAAAGAGGG - Intronic
952633842 3:35503370-35503392 GAACTTTTTTTTTCAAAAGATGG + Intergenic
952736072 3:36692699-36692721 TAATTTTTTTTTTCAAGAGAGGG - Intergenic
953316833 3:41935662-41935684 TAATCTTTTTTTAAAATAAAAGG - Intronic
953319190 3:41956754-41956776 TAAACTTTATTTACAAAAGCAGG - Intronic
953444020 3:42947008-42947030 TAACCTTTGCCTACAACAAAGGG - Intronic
953681356 3:45040885-45040907 TAACCTTTTTCTCCACTAGAAGG + Intergenic
955633326 3:60998819-60998841 TAACTTTTTTTAAAAAGAGAAGG + Intronic
955792665 3:62604693-62604715 TCACCTCCTTTTACAACAAAGGG - Intronic
955806667 3:62743294-62743316 TAAACTTTATTTACAAAAGCAGG - Intronic
955985875 3:64573464-64573486 TAAGGATTTTTGACAACAGATGG + Intronic
956047098 3:65207410-65207432 TAAACATTTTTCAAAACAGAGGG - Intergenic
956428410 3:69160126-69160148 TAAACTTTTTAAACTACAGAAGG + Intergenic
956806989 3:72824802-72824824 TTAACTTTTTTTAAAAGAGATGG + Intronic
957674739 3:83351918-83351940 TACCCTTTTTTTACAGAGGAAGG + Intergenic
957946480 3:87069578-87069600 TGTCCTTCTTTTGCAACAGAAGG - Intergenic
958073415 3:88643976-88643998 AAAACTTTTTTTAAAAAAGAGGG - Intergenic
959925343 3:111915180-111915202 TAATCTTTTGTTATAAGAGAAGG + Intronic
962236906 3:133714518-133714540 TAATTTTTCTTTACATCAGAAGG + Intergenic
962298208 3:134213314-134213336 TACCCTTATTTTACAAAATATGG - Intronic
963038902 3:141054379-141054401 TGATCTTTTCTTACCACAGATGG - Intronic
963568011 3:146954895-146954917 AAAACTTTATTTACAACAGCAGG - Intergenic
965215502 3:165859168-165859190 TAAGCTTCTTTCATAACAGAAGG + Intergenic
965279087 3:166725166-166725188 TAAATTTTTTTTCCAACACATGG - Intergenic
965279166 3:166726076-166726098 TAAACTTTTCTTCCAACAAATGG + Intergenic
965561465 3:170065925-170065947 TAACTTTTTTTTTTAAGAGATGG + Intronic
965700411 3:171454973-171454995 AAAACTTTTTTTAAAAAAGAAGG + Intronic
965906480 3:173713758-173713780 TAACCTTTGTTGAGTACAGATGG - Intronic
966316635 3:178654639-178654661 TAGACTTTTTTTAAAAAAGATGG + Intronic
966618840 3:181942013-181942035 AAACAGATTTTTACAACAGAGGG - Intergenic
968376273 4:44717-44739 TAACCCTTTCTTACAGAAGAAGG + Intergenic
970643879 4:18097451-18097473 GAACCTTTTATCACAGCAGAGGG + Intergenic
972088759 4:35254251-35254273 TAACCTTTATTTATATCACAAGG - Intergenic
972507104 4:39730187-39730209 TAACTTTTTTTTTTAAGAGATGG + Intronic
973233818 4:47873818-47873840 TAGCATTTTCTTTCAACAGAAGG + Intronic
973587159 4:52404962-52404984 AAAACTTTATTTACAAAAGAAGG - Intergenic
973931334 4:55795683-55795705 TAACACTTTTTTACAACAGAGGG - Intergenic
976586081 4:86798671-86798693 TAGCCTTTTGCTACAACAGGAGG - Intronic
976856324 4:89609385-89609407 TACAGTTTTATTACAACAGAAGG + Intergenic
976986801 4:91310694-91310716 GAACCCTTTTTTCCATCAGAAGG + Intronic
977253348 4:94713041-94713063 TGACCCTTTGTTACAAAAGATGG + Intergenic
977377626 4:96227095-96227117 TAACTTTTTTTAACTACATAAGG - Intergenic
977411168 4:96666209-96666231 TTTCCTTTTTCTATAACAGATGG - Intergenic
977856021 4:101894226-101894248 TTACATTTTTTTAAAAAAGAAGG - Intronic
979834094 4:125339595-125339617 TAACATTTATTTAAAACAAATGG + Intronic
979979517 4:127237332-127237354 GAATTTTTTATTACAACAGAAGG + Intergenic
980470624 4:133247019-133247041 TAAAGTTTTTTTAGAGCAGATGG + Intergenic
980606658 4:135099943-135099965 TAACATTTTTTTAGAAAAAATGG - Intergenic
980700794 4:136427308-136427330 AAATCTTTTTTTACACCATATGG - Intergenic
981185342 4:141795476-141795498 TAATTTTTTATTACAACTGAAGG + Intergenic
981614319 4:146631109-146631131 TCACATTTTTTTAAAACATAGGG + Intergenic
982982462 4:162156914-162156936 TAACTTTTTTTAAAAAAAGATGG + Intronic
983916916 4:173302166-173302188 TAACATTTTATTTCAACAGATGG + Intronic
984149208 4:176105781-176105803 CAACCTATTTTTACAACTTAAGG + Intronic
985364985 4:189220090-189220112 TAAATTTTTTTTTCAACAGAGGG + Intergenic
986076752 5:4345573-4345595 TATATTTTTTTTACAACATAAGG - Intergenic
987160649 5:15138722-15138744 TGACTATTTTTTATAACAGAGGG + Intergenic
987750334 5:22030748-22030770 TAGCCTCTTCTTCCAACAGAAGG + Intronic
988365306 5:30290647-30290669 TAACCTTCTTATGCAACATAGGG - Intergenic
988993985 5:36696989-36697011 TTAGCTATTATTACAACAGAAGG - Intergenic
989208273 5:38833060-38833082 TAAGCTTTTTTATCAGCAGAGGG - Intergenic
989425655 5:41292870-41292892 TTTACTTTTTTCACAACAGAAGG + Intergenic
989474168 5:41855743-41855765 TAACCTATAATTACAACAGAGGG + Intronic
991584796 5:68190934-68190956 TAACCTTTTTTAAAAAAAGCAGG + Intronic
992417769 5:76568587-76568609 TAATCTTGTTTGACCACAGAGGG - Intronic
994131178 5:96229900-96229922 TACTCTTGTTTTATAACAGAAGG - Intergenic
994273025 5:97804462-97804484 TAACTTTTAATTACTACAGAGGG - Intergenic
994438371 5:99767869-99767891 TAATCTTTTTATATAACAGAAGG + Intergenic
994796874 5:104314481-104314503 TAAATGTTTTTTACAACAGTGGG + Intergenic
995050300 5:107695919-107695941 TAACATTTTTTTTTAACCGAAGG - Intergenic
995522438 5:113023448-113023470 TAACATTTTTTTTCTGCAGAAGG - Intronic
995635339 5:114182930-114182952 TTACCTTTTTTCACAACATAGGG + Intergenic
997357516 5:133273290-133273312 TTACCTTCTTTTTCCACAGAAGG + Intronic
997975224 5:138438029-138438051 CAACCTTCTTTTCAAACAGAGGG - Intergenic
999823841 5:155255432-155255454 TAACCTCATTTTACAAATGAGGG + Intergenic
1000153664 5:158528929-158528951 TAACCTTTTTTCTGAACAAATGG + Intergenic
1000507844 5:162143955-162143977 TAACTTTCTTTTGAAACAGATGG - Intronic
1000786702 5:165553770-165553792 TAACCTTTTGTTATAACAACAGG - Intergenic
1007997039 6:46318693-46318715 TAACCTTCTGTTACCATAGAAGG - Intronic
1008322127 6:50128436-50128458 TAACCTTTTTCTACACTAAAAGG + Intergenic
1008453496 6:51681019-51681041 TAAACTTGCTTTACAATAGAGGG - Intronic
1009307541 6:62109117-62109139 CAACCTTTTTATACAACTGTTGG - Intronic
1009319506 6:62269681-62269703 TAACCTTTTATTATAATATATGG - Intronic
1009588191 6:65633787-65633809 TAAACTTTATTTACAAAAGTAGG - Intronic
1009962070 6:70535300-70535322 TACTGTTATTTTACAACAGATGG - Intronic
1010115540 6:72303790-72303812 TACCATTTTTTTAAAACATAAGG + Intronic
1011471735 6:87714874-87714896 TACTCTTTTTTTATAACAAAAGG - Intergenic
1011959278 6:93067500-93067522 TCACCTTTTCTTCCAACAGTGGG - Intergenic
1012137898 6:95581621-95581643 TAGCCTTTTCTTAAAAAAGAGGG - Intronic
1013634236 6:112013454-112013476 TAATTTTTTTTTCCAAAAGAAGG - Intergenic
1014309338 6:119781034-119781056 AAATCTTTTTTGACAACAAAGGG + Intergenic
1017068890 6:150554795-150554817 TAGCATTTTCTTCCAACAGAAGG - Intergenic
1017391500 6:153944752-153944774 TAACCTAATCTTACAACAGAGGG + Intergenic
1018250533 6:161865466-161865488 TGGCATCTTTTTACAACAGAAGG + Intronic
1018489132 6:164273596-164273618 TAAACTTTATTTACAAGAGTGGG - Intergenic
1020288310 7:6703376-6703398 TAAGCTATTTTTACAACAGCAGG + Intronic
1021154919 7:17198067-17198089 GAACCTAATTTTACAACAGGTGG - Intergenic
1021180210 7:17497309-17497331 TAATCTTGTTTCCCAACAGAAGG - Intergenic
1022314222 7:29229673-29229695 GAAACTTTATTTACAACAAAAGG - Intronic
1022590491 7:31656515-31656537 TAACAGTTCTTTTCAACAGAAGG - Intronic
1022691365 7:32658883-32658905 TAACTTTTTTTTTAAACAGAGGG - Intergenic
1023285303 7:38612879-38612901 TAACCTTCCTTTAGAATAGATGG - Intronic
1023428243 7:40062450-40062472 TAATTTTTTTTTAGTACAGATGG + Intronic
1024352757 7:48383831-48383853 AAATATTTTTTTAAAACAGAGGG - Intronic
1025103726 7:56153875-56153897 TAAAATTTTTTTAAAAAAGAAGG - Intergenic
1025772067 7:64518311-64518333 CAACTTTTTTTTACAATAGCTGG + Intergenic
1026767007 7:73166463-73166485 TAAACTTTTTTTAGAATAGCAGG + Intergenic
1027043492 7:74976199-74976221 TAAACTTTTTTTAGAATAGCAGG + Intronic
1027080154 7:75226160-75226182 TAAACTTTTTTTAGAATAGCAGG - Intergenic
1027307557 7:76916467-76916489 GAACATTTATTTACAACATACGG + Intergenic
1027681612 7:81229790-81229812 TAACATTTTTTTTCAATAAATGG - Intergenic
1027778460 7:82494505-82494527 TAACATTTTTTTAAAGCAGAGGG - Intergenic
1027856522 7:83518837-83518859 TAACCCTTGTTTCCATCAGAGGG + Intronic
1028864774 7:95695728-95695750 AAACCTCTGTTTCCAACAGATGG + Intergenic
1030206165 7:106954275-106954297 AAACGTTTTTTTCCAACAAAAGG - Intergenic
1030712450 7:112766249-112766271 TAACATTTTTTTTCTACTGAAGG - Exonic
1031272362 7:119667412-119667434 TAACCTTTTTTTTCAAACAAGGG + Intergenic
1031303550 7:120095217-120095239 TCAATTTTTTTTATAACAGAAGG + Intergenic
1031670239 7:124533803-124533825 TAATTTTTTTTTCCAAGAGAAGG - Intergenic
1031719487 7:125153412-125153434 TAACTTTTTTAAAAAACAGAAGG + Intergenic
1032089656 7:128904869-128904891 TTCCATTATTTTACAACAGATGG + Intronic
1032279325 7:130488139-130488161 GAGCCTTATTTTACATCAGATGG + Intronic
1032971843 7:137173617-137173639 TCACCTTTTTCTACCACAGTTGG - Intergenic
1033087831 7:138358498-138358520 TAACTTTTTCTCACAACAGAGGG - Intergenic
1033517451 7:142122044-142122066 TAACTTTTTTTTAAAAGAAATGG + Intronic
1034685455 7:152967086-152967108 AAACCCTTTTTCACAACAGAAGG - Intergenic
1034721246 7:153295236-153295258 ACAACTTTATTTACAACAGAGGG + Intergenic
1035416269 7:158690130-158690152 GAACATTTTTTTAAAACATAAGG + Intronic
1035899471 8:3443162-3443184 TCACATTTTTTTGCAGCAGAAGG - Intronic
1037156527 8:15707120-15707142 TAACCTAATTTTATATCAGATGG + Intronic
1037407464 8:18558340-18558362 AAAACTTTTTTTAGAAAAGAAGG - Intronic
1040662536 8:49592474-49592496 TAACCGCTTTGTAAAACAGATGG - Intergenic
1042116380 8:65436155-65436177 TCACCTTTTTTTTAAACAGGTGG + Intergenic
1042393168 8:68259460-68259482 TAACCATTTATTACTACAGAGGG + Intergenic
1042478419 8:69276460-69276482 TAACATTTTTTTAAAAGAGTAGG + Intergenic
1042795499 8:72658592-72658614 TAGCATTTTCTTCCAACAGAAGG - Intronic
1043138319 8:76556345-76556367 TAACCTTATTTTACAAAAGCGGG + Intergenic
1043629114 8:82306154-82306176 TAACATTTTTTTTAAAAAGAAGG + Intergenic
1043698658 8:83255008-83255030 TAATTTTTTTTTACAAATGAAGG - Intergenic
1043978801 8:86614617-86614639 TAACTTTTTTTTCCAGTAGAGGG + Intronic
1045480695 8:102589701-102589723 TATCCTTGTTTTTCAAAAGAAGG + Intergenic
1046005544 8:108478172-108478194 TAACCTTTTTTTGAATCACATGG + Intronic
1046138051 8:110056739-110056761 TATCCATTTGTTACAAAAGAAGG + Intergenic
1046402650 8:113725387-113725409 TAACATGTTCTTTCAACAGAGGG + Intergenic
1047265624 8:123305425-123305447 TAACCTAGTTTTACAACTTAAGG - Intergenic
1047809049 8:128388066-128388088 TAACCTTTTTCTAGAAATGAGGG + Intergenic
1047950173 8:129925983-129926005 AAACCTTTTACAACAACAGATGG + Intronic
1048372698 8:133793276-133793298 TACCCTTGTATTACAGCAGAAGG - Intergenic
1048564250 8:135578463-135578485 TAATGTTTTTTTTCAACAAATGG - Intronic
1050085195 9:1958233-1958255 TAGCCTTCTTTTACTGCAGAGGG - Intergenic
1050743348 9:8848161-8848183 TGACCTTTTTTTTCTGCAGATGG - Intronic
1050874617 9:10618292-10618314 TAACATTTTTTTAGTAGAGAAGG - Intergenic
1052292416 9:26858513-26858535 TAACCTTTTTTTAAAAAGCAGGG - Intronic
1052728116 9:32254164-32254186 TAACTATTTTTGAGAACAGAAGG - Intergenic
1052791889 9:32882912-32882934 TAATCTTATTTTACAAAAGGCGG - Intergenic
1053778211 9:41571812-41571834 TAACTGTTTTCTACAACTGATGG + Intergenic
1056305289 9:85284865-85284887 TATACTTTTATTACAACTGAAGG + Intergenic
1057633615 9:96741775-96741797 TAAACTTTTGTTCCAACAAATGG + Intergenic
1058229748 9:102411042-102411064 AAATCCTTTTTCACAACAGAGGG - Intergenic
1058399958 9:104604269-104604291 TTTGCTTTTTCTACAACAGAGGG + Intergenic
1058400796 9:104616842-104616864 TTTGCTTTTTCTACAACAGAGGG + Intergenic
1059258453 9:112952708-112952730 TAAAATTTTTTTAGTACAGATGG - Intergenic
1059522321 9:114955197-114955219 AAACCTTTATTTACAAAAGCAGG + Intergenic
1059561329 9:115337716-115337738 TAACTTTTTTTTTTAAGAGATGG + Intronic
1059993532 9:119887855-119887877 TATTCTTTTTTTTTAACAGATGG + Intergenic
1060891353 9:127190926-127190948 TATCTTTTTATTACAACAGATGG - Intronic
1061345064 9:130017073-130017095 TACCTTTTTTTTAAAAGAGATGG - Intronic
1062098610 9:134716206-134716228 TATCCTCTTTTATCAACAGATGG + Intronic
1203572953 Un_KI270744v1:149448-149470 TAACCCTTTCTTACAGAAGAAGG - Intergenic
1188480794 X:30635238-30635260 TTTCCTTTTTTTAATACAGACGG + Intergenic
1188521135 X:31039306-31039328 TACCCTTTTTTTCCAAGAGTTGG + Intergenic
1191658529 X:63627737-63627759 GAACATTTTTTAACAAAAGAAGG + Intergenic
1192710407 X:73577332-73577354 TAACTTTTTTTTAAAAAAAAGGG + Intronic
1193459094 X:81768927-81768949 TAACCTTGTTTTACAGAAAAGGG - Intergenic
1195422996 X:104696237-104696259 TCACCTGTTTTTAAAAGAGAGGG + Intronic
1196791321 X:119467966-119467988 TAAACTTTATTTACAAAACAAGG + Intergenic
1197297702 X:124739188-124739210 TATCCTTATTTTACAAATGAGGG - Intronic
1197343446 X:125302259-125302281 TAACCTTATTTTACTAAACAGGG + Intergenic
1200286591 X:154828590-154828612 TAACTATTGTTTACAACAGATGG + Intronic
1201322090 Y:12710667-12710689 TACCGTTTTTTTCCACCAGATGG - Intronic
1202106603 Y:21375416-21375438 GAAACTTTTTTTAGAACAAAGGG + Intergenic
1202341123 Y:23870018-23870040 AAACTTTTTTTAACAAAAGAAGG + Intergenic
1202529643 Y:25800068-25800090 AAACTTTTTTTAACAAAAGAAGG - Intergenic