ID: 1098830941

View in Genome Browser
Species Human (GRCh38)
Location 12:75361584-75361606
Sequence GACTCATGGTTCCACGTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7635
Summary {0: 1, 1: 11, 2: 159, 3: 1409, 4: 6055}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098830939_1098830941 7 Left 1098830939 12:75361554-75361576 CCTGTTTTAGCTGAGGAAAGAGA 0: 1
1: 0
2: 1
3: 38
4: 313
Right 1098830941 12:75361584-75361606 GACTCATGGTTCCACGTGACTGG 0: 1
1: 11
2: 159
3: 1409
4: 6055
1098830936_1098830941 23 Left 1098830936 12:75361538-75361560 CCAAGCTGTACCTCAGCCTGTTT 0: 1
1: 2
2: 6
3: 76
4: 681
Right 1098830941 12:75361584-75361606 GACTCATGGTTCCACGTGACTGG 0: 1
1: 11
2: 159
3: 1409
4: 6055
1098830935_1098830941 24 Left 1098830935 12:75361537-75361559 CCCAAGCTGTACCTCAGCCTGTT 0: 1
1: 2
2: 9
3: 63
4: 635
Right 1098830941 12:75361584-75361606 GACTCATGGTTCCACGTGACTGG 0: 1
1: 11
2: 159
3: 1409
4: 6055
1098830938_1098830941 13 Left 1098830938 12:75361548-75361570 CCTCAGCCTGTTTTAGCTGAGGA 0: 1
1: 0
2: 0
3: 14
4: 140
Right 1098830941 12:75361584-75361606 GACTCATGGTTCCACGTGACTGG 0: 1
1: 11
2: 159
3: 1409
4: 6055

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098830941 Original CRISPR GACTCATGGTTCCACGTGAC TGG Intronic
Too many off-targets to display for this crispr