ID: 1098831904

View in Genome Browser
Species Human (GRCh38)
Location 12:75374014-75374036
Sequence GAAAGCTCTTGGCCTGTAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 546
Summary {0: 1, 1: 0, 2: 4, 3: 202, 4: 339}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098831904_1098831908 16 Left 1098831904 12:75374014-75374036 CCACTTACAGGCCAAGAGCTTTC 0: 1
1: 0
2: 4
3: 202
4: 339
Right 1098831908 12:75374053-75374075 GTTATCTGCGGAAGATAGCAGGG 0: 1
1: 12
2: 193
3: 189
4: 213
1098831904_1098831907 15 Left 1098831904 12:75374014-75374036 CCACTTACAGGCCAAGAGCTTTC 0: 1
1: 0
2: 4
3: 202
4: 339
Right 1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG 0: 1
1: 11
2: 199
3: 201
4: 178
1098831904_1098831906 4 Left 1098831904 12:75374014-75374036 CCACTTACAGGCCAAGAGCTTTC 0: 1
1: 0
2: 4
3: 202
4: 339
Right 1098831906 12:75374041-75374063 AAAATGAAAGTAGTTATCTGCGG 0: 1
1: 2
2: 9
3: 64
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098831904 Original CRISPR GAAAGCTCTTGGCCTGTAAG TGG (reversed) Intronic
900331161 1:2135320-2135342 TAAAGCGCTTGGCTTGGAAGAGG - Exonic
900434961 1:2625612-2625634 GACAGCTCTTGGCCCGTTACTGG + Intronic
900544093 1:3218888-3218910 GAAAGCTCTTTGCAGGGAAGAGG - Intronic
901877214 1:12173740-12173762 CAAAGCCCTAGGCCTGGAAGGGG - Intronic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
902692107 1:18116482-18116504 GAGAGCTTTTGGCATGTAACTGG + Intronic
903543637 1:24110484-24110506 GAGAGCCGTTGGCCTGGAAGGGG + Intronic
904179491 1:28655935-28655957 GACAGCTCTTGGCCTATTACTGG - Intergenic
904335935 1:29798022-29798044 GACAGCTCTTGGCCTATTACTGG + Intergenic
905861838 1:41357330-41357352 GAATGGGCTTGGCCTGTAAGAGG + Intergenic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
906126604 1:43430939-43430961 GAAAGCACCTGGCCTGGGAGAGG - Exonic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910435857 1:87205040-87205062 GAAAGCTCTTGGACTTAACGCGG + Intergenic
910561903 1:88600017-88600039 GACAGCTCTTGGCCTGTTATTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910831095 1:91463388-91463410 GATAGCTCTTGGCCTGTTATTGG - Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
911345228 1:96688822-96688844 GAAAGCTGTTGGCCTGTAAATGG - Intergenic
911738395 1:101361883-101361905 CACAGCTCTTGGCCTGTTACTGG - Intergenic
911981897 1:104579226-104579248 GAAAACTCTTGGCCTGTTATTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912184280 1:107256218-107256240 GGAAGCTCATGGCCCATAAGAGG - Intronic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
913344455 1:117794092-117794114 GAAAGTTGTTGCCCTATAAGTGG + Intergenic
913675582 1:121137495-121137517 GACAGGTCTAGGCCTGTAGGGGG + Intergenic
914027478 1:143925436-143925458 GACAGGTCTAGGCCTGTAGGGGG + Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
916877423 1:168984438-168984460 GAAAGATCTTGGTGTGTCAGAGG - Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918918229 1:190671843-190671865 GACAGCTCTTGGCCTGTTAATGG - Intergenic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919241775 1:194924240-194924262 GACAGCTATTGGCCTGTTAATGG + Intergenic
919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG + Intergenic
920462946 1:206156331-206156353 GACAGGTCTAGGCCTGTAGGGGG + Intergenic
921823353 1:219642279-219642301 GAAAGTTATTGGCCTTAAAGAGG + Intergenic
922603869 1:226876920-226876942 GAGAGCTCTTGGGCTGAAAAAGG - Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
923543414 1:234906434-234906456 CAAAGTTCTTGGCCTGGTAGGGG - Intergenic
923769482 1:236925818-236925840 GAAATCTCTCTTCCTGTAAGAGG + Intergenic
924328770 1:242921765-242921787 GAAAGCACTTGGCATGTTTGGGG + Intergenic
924410198 1:243796500-243796522 GAAAGACCTTGGCTTTTAAGTGG - Intronic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1063944223 10:11161673-11161695 GTAAATTCTTGGACTGTAAGAGG + Intronic
1064545686 10:16448099-16448121 GACAGCTCTTGGCCAGTTACTGG - Intronic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1065039317 10:21675354-21675376 TGATGCTCTTGGCCTGTAGGGGG - Intronic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1067856389 10:49797113-49797135 GAACACCCTTGGCCTGGAAGAGG + Intergenic
1068007671 10:51409534-51409556 GACAGCTCTTGGCCTGTCACTGG - Intronic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068757507 10:60671296-60671318 GAAAGCACTTGGCCGGTTGGAGG - Intronic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1069192303 10:65506334-65506356 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1069790829 10:71019547-71019569 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071267084 10:83973966-83973988 GACAGCCCTTGGCCTGTTACTGG - Intergenic
1071376459 10:85010387-85010409 GAAAGCTTTAGACCTGTAATGGG + Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1071937690 10:90549312-90549334 GACAGCTCTTGGCCTGTTCCTGG + Intergenic
1073557351 10:104465936-104465958 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1073656679 10:105424448-105424470 TACAGCTCTTGGCCTGTTACTGG - Intergenic
1073841583 10:107504202-107504224 TAAACCTCTGGGCCTGTAATGGG + Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1075606791 10:123817435-123817457 GACAGCACTTGGCCTGTTACTGG + Intronic
1076039372 10:127230239-127230261 GAAAGCTCTTGTACAGTAAAAGG - Intronic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076927414 10:133499190-133499212 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1077631024 11:3811088-3811110 GATAGCTCTTGCCCTGGATGAGG - Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081569086 11:44278520-44278542 GCCAGCTCTTGGCCTTTCAGGGG + Intronic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081754448 11:45534671-45534693 GGTAGCTCTGGGCCAGTAAGAGG + Intergenic
1082203363 11:49401471-49401493 GAAAGCTCTTGAGGTCTAAGTGG + Intergenic
1082974732 11:59060291-59060313 GAATGCTTTTGGCCAGTAACTGG - Intergenic
1082979151 11:59104078-59104100 GAATGCTTTTGGCCAGTAACTGG - Intergenic
1082999663 11:59279889-59279911 GAGAGTTCTTGGCCTGTTACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086278614 11:85160462-85160484 AACAGCTCTTGGCCTGTTATTGG + Intronic
1086651671 11:89298625-89298647 GAAAGCTCTTGAGGTCTAAGTGG - Intergenic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088191659 11:107234480-107234502 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1088836657 11:113583399-113583421 GACAGCTCTTGGCCTGTCACTGG + Intergenic
1089147173 11:116337576-116337598 GAAACCCCATGGCCTGTAAGTGG - Intergenic
1089542571 11:119198756-119198778 GAAAGCCCTTGGCCTAGAGGAGG - Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1090221614 11:125031575-125031597 GACAGCTCTTAGCCTGTTACTGG - Intronic
1091607299 12:1965371-1965393 GAAAACTGTTTGCCTTTAAGTGG - Intronic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1093049669 12:14490952-14490974 GACAGCTCTTGGCCTGTTAAAGG - Intronic
1093645730 12:21583681-21583703 GAAAGCTCTTGGCCTGTTACTGG + Intronic
1095603855 12:44044345-44044367 GACAGCTCTTGGCCTGTTTCTGG + Intronic
1095844394 12:46729957-46729979 AACAGCTCTTGGCCTGTTAATGG - Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1096288713 12:50322971-50322993 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1096457465 12:51799426-51799448 GACGGCTCTTGGCCTGTTACTGG - Intronic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1097843356 12:64342750-64342772 AACAGCTCTTGGCCTGTTACTGG - Intronic
1098151079 12:67547246-67547268 AAAAGCTTTTTGCCTGTAAAGGG - Intergenic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1098733294 12:74065642-74065664 GAAAGCTCTTGGCTGGTTATTGG + Intergenic
1098831904 12:75374014-75374036 GAAAGCTCTTGGCCTGTAAGTGG - Intronic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099508562 12:83507198-83507220 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1100083304 12:90878223-90878245 GACAGCTCTTTGCCTGTTACTGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101697456 12:107139819-107139841 AAAAGCTCTTGGCCTGCTACTGG - Intergenic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1107638701 13:42419232-42419254 TGAAGCTCTTGTCCTGTAAGGGG - Intergenic
1107983575 13:45755961-45755983 GACAGCTCTTGGCCTATTACTGG - Intergenic
1108302433 13:49091974-49091996 GACAGCTCTTGGCCCGTTACTGG - Intronic
1109293225 13:60500129-60500151 GACGGCTCTTGGCCTGTTACTGG + Intronic
1109519023 13:63484812-63484834 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110481084 13:75977190-75977212 GAAAGCTCATCGGCAGTAAGAGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111317503 13:86581812-86581834 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
1112249926 13:97770267-97770289 GACAGCTCTTGGGCTGTTACTGG - Intergenic
1113024619 13:105926937-105926959 AAAAGCTCTGGGCCTGGAAAGGG + Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1115059717 14:29173905-29173927 GACAGCTCTTGGCTTGTAACTGG + Intergenic
1115130694 14:30049271-30049293 GACAGCTCTTGGCCTGTCACTGG + Intronic
1115945622 14:38656443-38656465 GTTAGCTCTGGTCCTGTAAGGGG + Intergenic
1116058909 14:39896949-39896971 GACAGCTCTTGGCCTGTTGCTGG + Intergenic
1116068095 14:40009182-40009204 AACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1116188812 14:41636404-41636426 TCAAGCTCTTGGTCTGAAAGAGG + Intronic
1116308043 14:43283436-43283458 GACAGCTCTTGGCCTGCTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118122433 14:62860159-62860181 GACAGCTCTTAGCCTGTTACTGG - Intronic
1118501835 14:66369400-66369422 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1119107563 14:71938828-71938850 GACAGCTCTTGGCCTATTACTGG - Intronic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1120973704 14:90230837-90230859 AGAAGCTCTTGGCCTGTTACTGG + Intergenic
1127356917 15:58209200-58209222 GACAGCTCTTGGCCTGTTATTGG + Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1132040825 15:98523458-98523480 GATAACGCTTGGCCAGTAAGGGG + Intergenic
1132762668 16:1518424-1518446 GGAGACTCTTGGCCTGTAAGAGG + Intronic
1134418198 16:14062600-14062622 GATTGGTTTTGGCCTGTAAGGGG + Intergenic
1135626004 16:23995507-23995529 GACAGCTCTTGGCCTGCTACCGG + Intronic
1136531413 16:30872192-30872214 GAAAGTCCTTGGCCAGGAAGGGG + Intronic
1136692623 16:32046358-32046380 GAAAGCTGTTAGCTTGTACGGGG + Intergenic
1136876733 16:33864473-33864495 GAAAGCTGTTAGCTTGTACGGGG - Intergenic
1138050527 16:53772255-53772277 GGAAGCACTTGCCCTGTTAGAGG - Intronic
1139162280 16:64525194-64525216 CAAAGCACTTGGCCTGTAGCAGG + Intergenic
1140415046 16:74768515-74768537 GAGATCACTTGGCCTCTAAGGGG - Intronic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142129684 16:88427017-88427039 GACTGCTCTGAGCCTGTAAGCGG + Intergenic
1203095376 16_KI270728v1_random:1251275-1251297 GAAAGCTGTTAGCTTGTACGGGG + Intergenic
1143711138 17:8736089-8736111 CATAGCTCCTGGCTTGTAAGTGG - Intronic
1143787254 17:9265266-9265288 GAAACCTCTTGCCCTGGAACTGG - Intronic
1145270084 17:21400226-21400248 GCAAGCTCCTGGCCTCTGAGCGG + Intronic
1145308307 17:21687675-21687697 GCAAGCTCCTGGCCTCTGAGCGG + Intergenic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1146850934 17:36221051-36221073 GACAGCTCTTAGCCTGTTACTGG + Intronic
1150950375 17:69797508-69797530 GAAAGATCTTGGCCTGTTCGAGG + Intergenic
1151203714 17:72489168-72489190 GAAAGCTCTGTGACTGCAAGAGG - Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1155940708 18:31799605-31799627 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159152205 18:64535031-64535053 GACAGCTCTTGGCATGTTACTGG - Intergenic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1159499477 18:69251143-69251165 GAAAACTGTTGACTTGTAAGAGG - Intergenic
1159559104 18:69975344-69975366 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1159760469 18:72419589-72419611 TACAGCTCTGGGCCTGTAATGGG - Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160532350 18:79572881-79572903 GGAAGCTGTTGGCATGGAAGTGG + Intergenic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1164500508 19:28815476-28815498 TAGAGCTCTGGGCCTGTGAGGGG + Intergenic
1167461330 19:49626020-49626042 CAAAGATCTTGGCCTGCAGGGGG - Exonic
925279953 2:2676875-2676897 GACAGCACTTGGCCTGTTACTGG + Intergenic
925499407 2:4486917-4486939 GAAAGCTCTTGACTTGTTACTGG - Intergenic
925947230 2:8876759-8876781 GAAAGCTCTTAGCATGGAATTGG - Intronic
926561944 2:14427232-14427254 GGAAGCTCTTGGCCTGGAGTGGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
926826763 2:16913675-16913697 GACAGATCTTGGCCTGTTACTGG + Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927660433 2:24988676-24988698 GACGGCTCTTGGCCTGTTACTGG + Intergenic
928159014 2:28904382-28904404 GAAAGTGCCTGGCTTGTAAGTGG + Intronic
928911998 2:36431038-36431060 TAAAACTTTTGGCATGTAAGAGG + Intronic
929269825 2:39960774-39960796 AACAGCTCTTGGCCTGTTACTGG - Intergenic
930412574 2:51044653-51044675 GAAAGTTCGTGGCATGTCAGGGG + Intergenic
931626649 2:64262337-64262359 GAAAGGTCTGGGCCTGGAAGAGG + Intergenic
932171839 2:69564702-69564724 GAAAGCCCTTGGCAGGTAAGAGG - Intronic
932870706 2:75395074-75395096 GACAGCTCCTGGCCTGTTACTGG - Intergenic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933276739 2:80292009-80292031 GAAAGCACTGGGCCTAAAAGAGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935050675 2:99522511-99522533 AAAAACTCTTAGTCTGTAAGTGG - Intergenic
935135320 2:100295319-100295341 GAACTCTCTTGGTCTGTAAATGG - Intronic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935425109 2:102911318-102911340 TACAGCTCTTGGCCTGTTACTGG - Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935944629 2:108274356-108274378 GACAGCTCTTGGCCTGCTACTGG - Intergenic
936481184 2:112886286-112886308 GAATGCTCTTGGCCAAGAAGAGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937047926 2:118862007-118862029 GAAACCTCTGGGCCTTTTAGGGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
937852569 2:126648729-126648751 GACAGCACTTGGCCTGTTACTGG - Intergenic
938056736 2:128221166-128221188 GAAAGCCCTTGGCCGATAGGAGG + Intergenic
938375539 2:130803381-130803403 GACAGCTCTTGGCCTGCTACCGG + Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939213873 2:139212249-139212271 GACAGCTCTTGGCCTGTTATTGG + Intergenic
939608240 2:144278465-144278487 TAAAGCTCTTGGCCCGTAGTAGG - Intronic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
940605915 2:155924279-155924301 GACAGCTCATGGCCTGTTACTGG - Intergenic
941330667 2:164174556-164174578 GACAGCTCTTTGCCTGTTACTGG - Intergenic
942520068 2:176794540-176794562 GAATGCACTTGGGGTGTAAGAGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943317928 2:186412310-186412332 GACAGCTCTTGGTCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
945085188 2:206124432-206124454 GAAAGCATGTGGCCAGTAAGGGG - Intronic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
945724810 2:213463421-213463443 TAGAGCTCCTGGCCTGTAATGGG - Intronic
945893503 2:215456279-215456301 GAAAGCTCTTTGCTTTTAAAAGG + Intergenic
946527867 2:220539958-220539980 GACAGCTCTTGGCCCGTTACTGG - Intergenic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
948364093 2:237443372-237443394 GAAAGCTGTGGGCCTGAAACAGG - Intergenic
1169688487 20:8304051-8304073 GACAGCTCTCTGTCTGTAAGGGG + Intronic
1173326608 20:42039145-42039167 GAAAGCACTTTGCATGTAACTGG - Intergenic
1175225948 20:57444078-57444100 GACAGGCTTTGGCCTGTAAGGGG + Intergenic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1178012661 21:28305184-28305206 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1178634467 21:34290206-34290228 GACAGCTCTTGGCCTGCTACTGG + Intergenic
1179383528 21:40921059-40921081 GACAGCTCTTGGCCTGCAACTGG + Intergenic
1179415149 21:41192512-41192534 GAGAGCTCTTGGCCTGTTACTGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181367436 22:22388935-22388957 GACAGCTCTTGGCCTATTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1183589575 22:38772004-38772026 GAAAGCTGTTGTCATGTCAGAGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949245869 3:1924931-1924953 GACAGCTCTTGGTCTGTTACTGG + Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951435291 3:22656015-22656037 AAAAGTTATTGGCCTTTAAGAGG - Intergenic
951970762 3:28441857-28441879 GACAGCTCTTGGTCTGTTACTGG - Intronic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
956360453 3:68441446-68441468 GATAGCTCTTGGCCTGTTACTGG + Intronic
956509662 3:69980380-69980402 GACAGCTCTTGGCCTATTACTGG + Intergenic
956703894 3:71982879-71982901 GACAGCTCTTGGCCTATTACTGG - Intergenic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959997860 3:112698328-112698350 GAGAGCTCTTGGCCTGCTACTGG + Intergenic
960349530 3:116575709-116575731 GACAGCTCTTGGTCTGTTACTGG + Intronic
961419961 3:126795362-126795384 TAAAGCACTTGGCATGTAATTGG + Intronic
962813630 3:138979617-138979639 CAAATCTCCAGGCCTGTAAGAGG + Intergenic
963331816 3:143923365-143923387 GACAGATCTTGGCCTGTTACTGG - Intergenic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
964679244 3:159318906-159318928 GACAGCTCATGGCCTGTTACTGG - Intronic
965226766 3:166000756-166000778 GACAGCTCTTGGCCTGTTAGTGG - Intergenic
965251332 3:166348259-166348281 GACAGCTCTTGGTCTGTTACTGG - Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
966445694 3:179998567-179998589 GACAGCTCTTGGTCTGTTACTGG + Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
970166012 4:13239241-13239263 GAAAGTTCTTTGCCTTTAAAGGG + Intergenic
970262721 4:14245338-14245360 GAAAGATCTTGGCTTCTAAAGGG - Intergenic
970793966 4:19890611-19890633 AAAACCTCTTTGCCTTTAAGTGG + Intergenic
970971721 4:21991808-21991830 GAAAGATCTTGGCATGTTTGAGG - Intergenic
971857653 4:32062825-32062847 CAAAGCTCTTGACCTGTTACTGG - Intergenic
971979294 4:33732865-33732887 GACAGCTCTTGGCCTGCTATTGG - Intergenic
972095494 4:35342697-35342719 GAATGCTCTTGGCCTGTTACTGG + Intergenic
972805917 4:42529335-42529357 GACAGCTCTTGGCTTGTTACTGG + Intronic
973052247 4:45610436-45610458 GAAACCTCTTTGCCTTTATGTGG + Intergenic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
973120980 4:46520890-46520912 TACAGCTCTTGGCCTGTTACTGG - Intergenic
973855809 4:55008932-55008954 GAAAGTTTTTGGCCTCTAGGGGG + Intergenic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974333305 4:60507136-60507158 CAAAGTTATTGGCCTGAAAGAGG + Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974727213 4:65812531-65812553 AACAGCTCTTGGCCTGTTACTGG + Intergenic
974746914 4:66088897-66088919 GACAGCTCTTGGTCTGTTACTGG - Intergenic
975024469 4:69531640-69531662 GACAGCTCATGGCCTGTTACTGG + Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975742137 4:77439716-77439738 GAAAACTCTTGGCCTGCCATTGG + Intergenic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
976034205 4:80795814-80795836 GACAGATCTTGGTCTGTTAGTGG - Intronic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977626275 4:99192646-99192668 GATAGCTCTTGGCCTGTTACTGG - Intergenic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978224084 4:106313692-106313714 GAAAGCCATTGGGCTTTAAGGGG + Intronic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
979888567 4:126062165-126062187 GATAGCTCTTGGCCTGCTATTGG - Intergenic
979898401 4:126189049-126189071 GAAAGCTCTTGGCCTTTTACTGG - Intergenic
980227077 4:130000189-130000211 AAAAGCTATTGGCCTTAAAGAGG + Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980497526 4:133605354-133605376 GACAGCTCTTGGCCTGTTATTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982835540 4:160116649-160116671 GAGAGCTCTTGGCCTGTTACTGG + Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983582676 4:169324820-169324842 GACAGCTCTTGGCTTGTTACTGG + Intergenic
984060283 4:174982016-174982038 GACAGCTCTTGGCCTGCTACTGG - Intergenic
985893831 5:2737782-2737804 GAAAGCTGTTGGCCTGGCACCGG - Intergenic
986025575 5:3847422-3847444 GATAGCTCTTGGCCTGTTGCTGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986087110 5:4462726-4462748 GACAGCTCTTGGCCTGTTAGTGG + Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
986938331 5:12918742-12918764 GACAGCTCTTGGCCTATTACTGG - Intergenic
987153177 5:15061674-15061696 AACAGCTCTTGGCCTGTTACTGG + Intergenic
987468188 5:18296976-18296998 GACAGCTCTTGGCCTATTACTGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988184691 5:27845464-27845486 GAAAGATCTTGGCCTTTCTGAGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
988228769 5:28448135-28448157 GACAGCTCATGGCCTGTTACTGG + Intergenic
988562131 5:32290856-32290878 GACAGCTCTTGGCCCGTTACTGG + Intronic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989307502 5:39974614-39974636 CACAGCTCTTGGCCTATAACTGG - Intergenic
989426628 5:41303546-41303568 GAAAGCTCTGGTCCTCAAAGGGG + Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991196242 5:63935828-63935850 GAAAGCTATTGGCATCTAATGGG - Intergenic
991570346 5:68047250-68047272 GAATGCTCTTACACTGTAAGTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
993319827 5:86458587-86458609 GATAGCTCTTGGCTTGTTACCGG + Intergenic
993412581 5:87591803-87591825 GGAAGCTCTTGGCCTGTTACTGG - Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994855434 5:105113575-105113597 GACAGCTCTTGGCATGTTACTGG - Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995427732 5:112043717-112043739 CAAAGCTCTTGGCCTGTTACTGG - Intergenic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
996018561 5:118567865-118567887 GACAGCTCTTGGTCTGTTACTGG + Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
996825564 5:127677844-127677866 GACAGCTCTTGGCCTGTTATTGG + Intergenic
996912233 5:128668983-128669005 AACAGCTCTTGGCCTGTTACTGG + Intronic
997834775 5:137183395-137183417 GAAAGTTATTGGCCTTAAAGAGG + Intronic
998290335 5:140908542-140908564 GACAGCTCTTGGCCTATTACTGG - Intronic
998560472 5:143166596-143166618 GAAAGCACTGGGGCTGTCAGGGG - Intronic
998977919 5:147668576-147668598 GAAACTTCCTGGCCTGTAGGAGG - Intronic
999351386 5:150874854-150874876 GACAGCTCTTGGCCTGTCACTGG + Intronic
1000416973 5:160993911-160993933 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1000422870 5:161058029-161058051 GAGAGCTCTTGGCCTGCTACTGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1003791221 6:9550001-9550023 GACAGCTCTTGGCCTATTACTGG + Intergenic
1004574810 6:16885525-16885547 GAATGCCCTTGCCCTGGAAGAGG - Intergenic
1004824288 6:19403226-19403248 GACAGCTCTTGGACTGTTACTGG - Intergenic
1006001557 6:30969085-30969107 GACAGCTCTTGGCCTATTACTGG + Intergenic
1006062352 6:31433232-31433254 GACAGCTCTTAGCCTGTTACTGG + Intergenic
1006220268 6:32484124-32484146 GAAGGCTCTGGGCCTGGAGGCGG - Intergenic
1006418614 6:33919772-33919794 GAAAGGCCTTGGCCTGCAGGTGG + Intergenic
1006822174 6:36905639-36905661 GAAAACTCTGGGTCAGTAAGAGG - Intronic
1007191395 6:40022093-40022115 GAAGCCACTTGGCCTGTTAGGGG + Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1008820399 6:55625162-55625184 GATAGCTCCTGGCCTGTTAATGG + Intergenic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1009660694 6:66606912-66606934 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1009770333 6:68136842-68136864 GATAGCTCTTGGCCTGCTACTGG - Intergenic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011069102 6:83361675-83361697 GACAGCTCCTGGCCTGTTACTGG + Intronic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1014363396 6:120508344-120508366 GAGAGCTCTTGGCCTGTTACTGG - Intergenic
1014416987 6:121195399-121195421 GACAGCTCTTGGCATGTTACTGG + Intronic
1014534196 6:122596612-122596634 GAGAGCTCTTGGCCTATTACTGG - Intronic
1014895655 6:126896584-126896606 GACAGCTCTTGGCCTGATAATGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1015475750 6:133657501-133657523 GACAGCTCTTGGCTTGTTACTGG + Intergenic
1015611853 6:135030633-135030655 AAAAGCTAATGGCCTTTAAGAGG + Intronic
1016132838 6:140497997-140498019 AACAGCTCTTGGCCTGTAATTGG - Intergenic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016174914 6:141069085-141069107 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1016576257 6:145572577-145572599 GACAGCTCTTGGTCTGTTACTGG - Intronic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1018815382 6:167326486-167326508 TCAAGCACTTGGCCTGTAAATGG - Intronic
1020118227 7:5488207-5488229 GCAAGCTCCCGGCCTGCAAGGGG + Intronic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020685372 7:11287241-11287263 GAAGGCTCTGGGCATGAAAGTGG - Intergenic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1023501856 7:40859307-40859329 GAAAGTTCATGGCCTTTAATGGG + Intronic
1023866167 7:44239378-44239400 CAAGGCTCCTCGCCTGTAAGAGG - Intronic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024662253 7:51509608-51509630 AAAAGGTTTTGGCCTATAAGAGG - Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1026134541 7:67647716-67647738 GCAAGCTCTGGGCCTGGCAGAGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1027799766 7:82736452-82736474 AAATGCTCTTGGCCTGTTATTGG + Intergenic
1027953518 7:84850663-84850685 GAAAACTCTTTGCGTGTAAAGGG + Intergenic
1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG + Intergenic
1028237821 7:88382830-88382852 GACAGCTCTTGGCCTATTACTGG + Intergenic
1028866424 7:95718844-95718866 AAAACTTCTTGGCATGTAAGAGG + Intergenic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1029148398 7:98463161-98463183 GGACGCTCTTGGCCTGGGAGTGG - Intergenic
1029673017 7:102047027-102047049 AGAAGCTCTTGGTCTGGAAGGGG - Intronic
1030368754 7:108674036-108674058 GACAGATCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031131991 7:117843512-117843534 GAAAGCTCTAGGGCTGGAACAGG + Intronic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1039235324 8:35496638-35496660 GAAATCTTATGGCATGTAAGTGG - Intronic
1039501923 8:38024694-38024716 GAATGCTCTTGGCCTAGAGGAGG - Intergenic
1039838904 8:41279675-41279697 GAAAGCTCTTGGAGGGAAAGGGG - Intronic
1041934554 8:63321338-63321360 GACAGCTCTCGGCCTGTTACTGG + Intergenic
1041986182 8:63924481-63924503 GATAGCTCTTGGCCTGTCACTGG + Intergenic
1042001060 8:64123988-64124010 GACAGCTCTTGGCTTGTTACGGG - Intergenic
1043311847 8:78870590-78870612 AAAAGCTATTGGCCTTAAAGAGG - Intergenic
1044150800 8:88773083-88773105 GACAGCTCTTTGCCTGTTAGTGG + Intergenic
1044487150 8:92767114-92767136 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1045795906 8:106043881-106043903 GGAAGCCTTTGGCCTATAAGGGG - Intergenic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046417637 8:113937786-113937808 GACAGGTCTTGGCCTGTTACTGG - Intergenic
1046509675 8:115186486-115186508 CAAAGCTCCTGTCCTCTAAGAGG + Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046962840 8:120127841-120127863 GAAGGCTCTTGTCCTTTAAAGGG - Intronic
1047453631 8:124989321-124989343 GATAGCTCTTGGCCTGCTACTGG + Intergenic
1047976328 8:130133965-130133987 AAAAGCTCTTGGTCTCTAAAGGG + Intronic
1049370986 8:142267194-142267216 GAAATCACTTGGTCTGTAATGGG - Intronic
1049661031 8:143819841-143819863 GAGAGCTCTTGGCCTGCCTGGGG - Intronic
1050482675 9:6102611-6102633 GACAGCTCTTGGCCTATTACTGG + Intergenic
1051167777 9:14283557-14283579 GACTGCTCTTGCCCTGAAAGAGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1057093212 9:92279475-92279497 GAAAGCTGTTGGCCACAAAGAGG - Intronic
1057713217 9:97465978-97466000 GAGCGCTCTTGGACTGTGAGGGG + Intronic
1057797827 9:98171161-98171183 GAAAGCTCTGTGCCAGAAAGCGG - Intronic
1058544165 9:106042742-106042764 GACAGCTCTTGGCCTATTACTGG - Intergenic
1059196505 9:112375860-112375882 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1061964642 9:134006116-134006138 GAAACCTCTGGGCCTGTTAGAGG + Intergenic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1186469766 X:9812101-9812123 TAAAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1187952340 X:24483579-24483601 GAATGAAGTTGGCCTGTAAGAGG + Intronic
1188952554 X:36394093-36394115 GAAAGCCCCTGGGCAGTAAGTGG + Intergenic
1189154883 X:38746714-38746736 GACAGTTCTTGGCCTGTTACTGG - Intergenic
1189707224 X:43770857-43770879 CATAGCACTTGGCCTGTAAGAGG + Intronic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191658804 X:63629799-63629821 GACAGCTCTTGGCTTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1192898704 X:75471916-75471938 GACAGCTCTTGGCCTATTACTGG + Intronic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193447157 X:81618777-81618799 GACAGCTCTTGGCCTATTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193914801 X:87351922-87351944 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1194849245 X:98852168-98852190 GACAGCTCTTGGTCTGTTACTGG - Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1196135968 X:112209837-112209859 GACAGCTCTTGGACTGTTACTGG - Intergenic
1196301966 X:114058255-114058277 GAAAAATCTTGGCCAGAAAGGGG + Intergenic
1196525475 X:116724412-116724434 GCAAGCTCCTGGCCTGGAGGCGG + Intergenic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197380000 X:125727899-125727921 GACAGCTCTTAGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1197599207 X:128508037-128508059 TAGAGCTCTGGGCCTGTAATGGG - Intergenic
1198201419 X:134422899-134422921 CAAAGCACTTGTCCTGTTAGAGG + Intronic
1198701301 X:139400302-139400324 GACGGCTCTTGGCCTGTTACTGG + Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1199024380 X:142919725-142919747 GACAGCTCTTGGACTGTTACCGG + Intergenic
1199040592 X:143111106-143111128 GACAGCTCTTGGTCTGTTACTGG + Intergenic
1199144441 X:144348959-144348981 AACAGCTCTTGGCCTGTTACTGG - Intergenic
1199310426 X:146314394-146314416 GACAGCTCTTGGCCCGTTACTGG - Intergenic
1199737371 X:150696419-150696441 GGAAGCTGTGGTCCTGTAAGAGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201226150 Y:11820810-11820832 GAAAGCACTTGGCATGTTTGGGG + Intergenic
1201311313 Y:12600424-12600446 GAAAGCTCTAGGCCAGTCAAAGG + Intergenic
1201353248 Y:13069468-13069490 AAATACTCTTAGCCTGTAAGAGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202134541 Y:21648071-21648093 GAGAGATCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic