ID: 1098834629

View in Genome Browser
Species Human (GRCh38)
Location 12:75407160-75407182
Sequence GGGATTTATAGCCATGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 2, 2: 27, 3: 114, 4: 331}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098834629_1098834634 -1 Left 1098834629 12:75407160-75407182 CCTACTCCATGGCTATAAATCCC 0: 1
1: 2
2: 27
3: 114
4: 331
Right 1098834634 12:75407182-75407204 CCACTTATCCTTGCTGTGTTTGG 0: 1
1: 2
2: 7
3: 45
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098834629 Original CRISPR GGGATTTATAGCCATGGAGT AGG (reversed) Intronic
900779079 1:4605818-4605840 GTGATTTAAAACCATGGGGTTGG - Intergenic
900843025 1:5071020-5071042 GGGATTCATAGCCAAGGAGCAGG - Intergenic
900913648 1:5619594-5619616 AGGATTTATAGCCAAAGAGCAGG + Intergenic
901540588 1:9912693-9912715 GGAGTTTATAGCCATGCTGTGGG - Intergenic
902553390 1:17232699-17232721 GGTACTAAGAGCCATGGAGTGGG + Intronic
902591694 1:17479648-17479670 GGGATTTATAGCCATAGCGGTGG + Intergenic
902665018 1:17931394-17931416 AGGAATTACAGCCATGGAGGCGG - Intergenic
902982986 1:20138928-20138950 GGAATTCATAGCCAAGGAGCAGG - Intergenic
903517957 1:23925090-23925112 GAAATTTATAGCCAAGGAGCAGG - Intergenic
904523784 1:31116385-31116407 GGGATTGAAAGCCATGGAATTGG - Intergenic
904588784 1:31595837-31595859 GGAGTTTATAGTCATGGAGCAGG - Intergenic
905891163 1:41519237-41519259 GGGCTTTGTAGGCATGGAGCAGG - Intronic
906665078 1:47615746-47615768 GGGAATTATAGCCAAGGAGCAGG + Intergenic
907070667 1:51531766-51531788 GGCATTTAAAGCCATGAGGTTGG + Intergenic
907688560 1:56638439-56638461 GAGATTTATAGCCAAGGAGGAGG - Intronic
907763836 1:57388801-57388823 GAGATTTAGGGTCATGGAGTAGG - Intronic
908019534 1:59886004-59886026 GGTATTTATAGCCAAGAAGCTGG - Intergenic
908588149 1:65597191-65597213 GGAATTTATAGCCAAGAAGGAGG - Intronic
909207435 1:72777090-72777112 GGGATTTACAGCTAAGGAGCAGG - Intergenic
910365895 1:86465267-86465289 GGAATTTATAACCAAGGAGAAGG + Intergenic
910439974 1:87241993-87242015 GGGGTTTACAACCATGGAGTAGG + Intergenic
910440072 1:87242676-87242698 AGGATTTAAACCTATGGAGTAGG + Intergenic
910719681 1:90272387-90272409 GGGATTTATAGCCAAGGAGAAGG - Intergenic
910852032 1:91657799-91657821 GGTACTTAAAGCCATAGAGTGGG - Intergenic
911271647 1:95808799-95808821 GGGATTTATAGCCAAGAAGCAGG - Intergenic
911416421 1:97580881-97580903 GGAAGTAATAGCCAAGGAGTAGG - Intronic
911763191 1:101640426-101640448 GTTATTTATAGCCAAGGAGAAGG + Intergenic
911936766 1:103986398-103986420 GGAATTTATTGCCAAGGAGGAGG + Intergenic
912223079 1:107699834-107699856 GAGATTTATAGCCAAGGAGGAGG + Intronic
912486577 1:110033912-110033934 GGGATTTATAACCAAAGAGCAGG - Intronic
912692603 1:111815645-111815667 CGAATTTATAGCCAAGGAGCAGG - Intronic
918111608 1:181459704-181459726 GGGTTTTACATGCATGGAGTTGG - Intronic
919341553 1:196314321-196314343 GAGATTTATAGCTAGTGAGTAGG - Intronic
919864440 1:201769568-201769590 GGGATTTGTTTCCATGAAGTAGG + Intronic
920003884 1:202818411-202818433 GGGAATTGTAGGCAGGGAGTGGG + Intergenic
920286268 1:204882034-204882056 GGAATTTATAGCCAAGAAGCAGG - Intronic
922014829 1:221634704-221634726 TGGATTTATAGCCAAGGAGAAGG + Intergenic
924669095 1:246104997-246105019 GGAATTTATAGCCAAAGAGGAGG + Intronic
924803580 1:247345381-247345403 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1063849184 10:10164725-10164747 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1064997505 10:21309655-21309677 GGGATTCATAGCCAGGAAGTAGG - Intergenic
1065067205 10:21982074-21982096 GAGATTTATAGCCAAGGAACAGG - Intronic
1067522065 10:47015176-47015198 AGGATTTATAGCCAAGGTGCAGG + Intergenic
1067708587 10:48629341-48629363 GGGATTGACACCCATGGAGAGGG - Intronic
1068719179 10:60223300-60223322 GGAATTTATAGCCAAGGAGTAGG - Intronic
1068887488 10:62112365-62112387 GAGATTTATAGCCAAGGGGCAGG + Intergenic
1069373377 10:67769760-67769782 GGCATTTCCAGCCATGGAGCAGG + Intergenic
1070368851 10:75762597-75762619 AGGATATATAGCCATTAAGTGGG - Intronic
1071424985 10:85540378-85540400 GGAATTTATAGCCAGAGAGCAGG + Intergenic
1071586709 10:86830076-86830098 GGAATTTGTAGCCAAGGAGCTGG + Intronic
1071639683 10:87294244-87294266 GGCACTTTTAGCCATGGAGCAGG + Intergenic
1071651152 10:87394249-87394271 GGGAATTATAGTCAAGGAGGAGG - Intergenic
1073531633 10:104237862-104237884 GGAATTTATAGCCAAGGAGCAGG - Intronic
1074047438 10:109851519-109851541 GCAATTTATAGCCAAGGAGCAGG - Intergenic
1074443365 10:113497892-113497914 GAGATTGATAGTCAGGGAGTAGG - Intergenic
1075149595 10:119915113-119915135 TGGATTTATAGTCAGTGAGTTGG + Intronic
1078708295 11:13766054-13766076 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1080855563 11:36108890-36108912 GGAATTTTTAGCCAAGCAGTAGG + Intronic
1081674469 11:44960464-44960486 GGGATTTCTCACCATGGGGTGGG - Intergenic
1083127610 11:60587395-60587417 GGGAGTTCTTGCCCTGGAGTGGG - Intergenic
1084148097 11:67275595-67275617 GGGCTTCACAGCCAAGGAGTGGG - Intronic
1084493246 11:69489529-69489551 GGTATTTTTAGCCCTGGAGCCGG + Intergenic
1084661158 11:70547129-70547151 GGGATTTAGGGCCCAGGAGTGGG - Intronic
1085844868 11:80053358-80053380 GGGACTTATAGCCATTTATTGGG + Intergenic
1086191534 11:84084902-84084924 GGGATTTACAGCCAAGGAGCAGG - Intronic
1086836544 11:91631323-91631345 GAGATTTATAACCAAGGAGTAGG + Intergenic
1086989944 11:93291890-93291912 AAGATTTATAGCCAAGGAGCAGG + Intergenic
1087403835 11:97703530-97703552 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1087642294 11:100768259-100768281 GGAATTTATTGCCAAGGAGCAGG + Intronic
1088145423 11:106670976-106670998 GGGATTTATAGCCAACAAGCAGG - Intergenic
1088842104 11:113635790-113635812 GGGATTTATAGCCAATGACAGGG - Intergenic
1091047751 11:132339621-132339643 TGCATTTATAGCCTTGGAGGTGG - Intergenic
1091922927 12:4320463-4320485 GAGATTTATAGCCAGGGGGCGGG + Intergenic
1094122212 12:26986423-26986445 GGAATTTGTAGCCAAGCAGTAGG - Intronic
1094177143 12:27552804-27552826 GGCATTTATAGCCAAGGAGCAGG + Intronic
1094220210 12:27984912-27984934 GCTGTTTATAGCCATGGAGTTGG - Intergenic
1094364531 12:29665961-29665983 GGAATTTATAGCCAGTGAGCAGG - Intronic
1094762932 12:33556314-33556336 GGAATGTATAGTCAAGGAGTAGG + Intergenic
1095367488 12:41425340-41425362 TGGAAGTATAGCCAAGGAGTAGG + Intronic
1095541231 12:43310849-43310871 GAGACTTATAGCCAAGGAGCAGG - Intergenic
1096317835 12:50584113-50584135 GGCATTTAAAGCCATGGAAGTGG - Intronic
1097387218 12:58963820-58963842 GGACTTTATAGCCAAGGAGCAGG - Intergenic
1098834629 12:75407160-75407182 GGGATTTATAGCCATGGAGTAGG - Intronic
1098908064 12:76181546-76181568 GGGATTTATAGCCACGGAGCAGG + Intergenic
1099926796 12:89028174-89028196 GGAACTTATAGCCATAGAGCAGG - Intergenic
1100225346 12:92550724-92550746 GGGATTTGAATCCATGCAGTTGG + Intergenic
1100763719 12:97839196-97839218 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1100989223 12:100234304-100234326 GGAATTTATAGCCAAGAAGCAGG + Intronic
1101153796 12:101908520-101908542 CGAATCTATAGCCAAGGAGTAGG + Intronic
1101443112 12:104718282-104718304 GGGATTTGAACCCAGGGAGTTGG + Intronic
1101920625 12:108929691-108929713 GGGATTTATAGCCAGGGAGCAGG - Intronic
1102637521 12:114337030-114337052 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1102677913 12:114671071-114671093 GGGATTTAAAGGGAAGGAGTGGG - Exonic
1105587557 13:21759023-21759045 GGGATTCATAGCTAAGGAGCAGG + Intergenic
1105770957 13:23611322-23611344 GGGATATATAGCCAAGGAGCAGG + Intronic
1105815462 13:24032236-24032258 GGAATTTATAGCCAAGGAGCAGG - Intronic
1106332709 13:28754220-28754242 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1106825850 13:33519519-33519541 GGAATTTATAGCCAAGGAGGAGG - Intergenic
1106942603 13:34794595-34794617 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1107589104 13:41883040-41883062 GGGATTTATAACCATGGAAAGGG - Intronic
1108283593 13:48883576-48883598 GGGATTTATAGCCAAGGACAAGG - Intergenic
1108481191 13:50873879-50873901 GGAATTTATAGCCAAGCAGCAGG + Intergenic
1108824492 13:54395765-54395787 TGGATTTATAGCCAAGGAGTGGG + Intergenic
1109342998 13:61085762-61085784 GGGATTTTTAGTCAAGGAGTAGG + Intergenic
1109935789 13:69282661-69282683 GGAATTTATAGTCAAGGAGCAGG + Intergenic
1110484838 13:76026549-76026571 ATTATTTAAAGCCATGGAGTAGG - Intergenic
1110959810 13:81607455-81607477 GGAATTTATAGCCAAGGGGAGGG - Intergenic
1111192598 13:84830333-84830355 GGGATTTATAGCCAAGGACCAGG + Intergenic
1111427219 13:88102778-88102800 GGGATTTATAGCCAAGGAGAAGG + Intergenic
1112027612 13:95426122-95426144 AGAATTTATAGCCAAGGAGAGGG + Intergenic
1112414778 13:99195178-99195200 GGGATTTATAATCAAGGAGCAGG - Intergenic
1112769416 13:102779812-102779834 GGCATTTATAGCCAAGGAGCAGG + Intergenic
1113098248 13:106689276-106689298 GGCATTTGAAGGCATGGAGTAGG + Intergenic
1113528918 13:111005548-111005570 GGAATTTGTAGCTAAGGAGTAGG - Intergenic
1114555215 14:23558236-23558258 GGAAGCTATAGCCATGGGGTGGG - Intronic
1115100575 14:29693664-29693686 AGGATTTTTAGCCATGGTGTTGG - Intronic
1116132850 14:40880982-40881004 GGGATTTATAGTCAAGGAAGTGG + Intergenic
1116201396 14:41802261-41802283 GGGATTTATAGCCGAGGAACAGG + Intronic
1116425318 14:44783469-44783491 GGAATTTACAGCCAAGGAGTAGG + Intergenic
1117937712 14:60926065-60926087 GGGATTTCTAACCAGAGAGTAGG - Intronic
1118065928 14:62190069-62190091 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1118523212 14:66610766-66610788 GGAATTTATAGCCAATGAGAAGG + Intronic
1120647891 14:87095123-87095145 GGCATTTAGAGCCATGAAGCTGG + Intergenic
1121263256 14:92581850-92581872 GGGGGTTATAGCCAAGGAGCAGG + Intronic
1121580133 14:95023941-95023963 GGGGTTGACAGCCATTGAGTGGG + Intergenic
1123077686 14:105677346-105677368 GGGATTGACAGCCAGGGAGCTGG - Intergenic
1123180759 14:106468064-106468086 GGGATTTAAAGCCAAGCAGCAGG + Intergenic
1202946139 14_KI270726v1_random:28594-28616 GGGATTTAAAGCCAAGCAGCAGG - Intergenic
1124911874 15:33929110-33929132 GGGCCTTAGAACCATGGAGTTGG + Intronic
1125333534 15:38605206-38605228 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1126209313 15:46081680-46081702 AGGATTTATAGCCAAGAAGCTGG - Intergenic
1126493718 15:49267186-49267208 GGAAGTTATAGCCAAGGAGCAGG + Intronic
1127086057 15:55425420-55425442 GGGGTTTATAGCCAAGGAGTAGG - Intronic
1128251070 15:66164756-66164778 AGGATTTATAGCCATGCATAAGG + Intronic
1128480353 15:68032248-68032270 AGAATTTATAGCCAAGGAGCAGG - Intergenic
1129147209 15:73659440-73659462 GGAATTTATAACCAAGGAGCAGG - Intergenic
1129491018 15:75925810-75925832 GGGATTTATAGCCAAGGAGGAGG + Intronic
1130017239 15:80196952-80196974 GAGAGCTATAGCCATGGAGAAGG - Intergenic
1130212488 15:81937861-81937883 GGGAATTGTAGCCCAGGAGTAGG + Intergenic
1131162457 15:90116402-90116424 GGGATCTATAACCAAGGAGCGGG + Intergenic
1131656369 15:94463097-94463119 GGGCTTTCTAGAAATGGAGTTGG - Intronic
1132335203 15:101043988-101044010 GGTACTCATAGCCATGGTGTCGG + Intronic
1132351628 15:101142915-101142937 GGAATGTAGGGCCATGGAGTAGG - Intergenic
1132438249 15:101830983-101831005 GGAATTTATGGCTATGGAGCAGG + Intergenic
1133260385 16:4545696-4545718 GAGATTGATAGCCAAGGAGTGGG - Intergenic
1136085047 16:27878868-27878890 GGGATTCACAGCCAAGGAGCAGG + Intronic
1137376056 16:47952831-47952853 GGGATTTACAGCCAAGCAGTAGG + Intergenic
1137814375 16:51384268-51384290 GGGATTTATAGCCAAGGAACAGG - Intergenic
1138546985 16:57725766-57725788 GGGATGTCTAGCAATGGAGTAGG + Intronic
1139556001 16:67710803-67710825 GGGATTGATAGTCAAGGAGCAGG - Intronic
1142821951 17:2476308-2476330 GTGATTTATTTGCATGGAGTTGG + Intronic
1143362720 17:6384674-6384696 GGCATCTGGAGCCATGGAGTGGG - Intergenic
1143750595 17:9023814-9023836 GGGATTTGTAGGTGTGGAGTTGG - Intronic
1144344866 17:14340417-14340439 GGGGTTTAGAGCCAAGGAGCAGG - Intronic
1144588245 17:16501989-16502011 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
1145815373 17:27791563-27791585 GGAATTTATAGCCAAGGATCAGG - Intronic
1146638856 17:34525506-34525528 GGGGGTTAAAGCCATGGAGAGGG + Intergenic
1146665592 17:34700730-34700752 GGAACTTATAGCCAAAGAGTGGG + Intergenic
1147590256 17:41678534-41678556 GGGATTTATAGCCAAGGAACAGG - Intergenic
1147871274 17:43589215-43589237 GAGATTTATAGCCAAGGAACAGG - Intergenic
1149454473 17:56776835-56776857 GGTATTTAATGCCATGGAGTGGG - Intergenic
1152219728 17:79056610-79056632 GGGATTTATAGCCGGGGAGCAGG + Intergenic
1152258853 17:79255766-79255788 GGGAATTGCAGCCATGGAGGAGG - Intronic
1152408691 17:80111378-80111400 TGGATTTCTAGCCAGGGAGCAGG + Intergenic
1153439591 18:5101774-5101796 GGGATTTATAACAAAGGAGCAGG + Intergenic
1153453568 18:5256547-5256569 GAAATTTATAGCCAAGGAGCAGG - Intergenic
1153614674 18:6923543-6923565 GGGGTTTCTAGCCAAGGAGCAGG - Intergenic
1155295523 18:24381187-24381209 TGGGATTATAGCCAAGGAGTAGG + Intronic
1155310148 18:24515353-24515375 GGAATTTACAGCCAAGGAGCAGG - Intergenic
1155602180 18:27562367-27562389 GAGATTTATAGCCAAGGAGTAGG + Intergenic
1155707038 18:28828722-28828744 GGGATTTGTAACCAAGGAGCAGG - Intergenic
1156526085 18:37768583-37768605 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1156758906 18:40562664-40562686 TGGATTTGTAGTCATTGAGTAGG + Intergenic
1156993858 18:43442754-43442776 GGCATTTATAGAAATGGTGTTGG + Intergenic
1158383785 18:56966157-56966179 AGGATTTATAACCAAGGAGCAGG + Intronic
1159036141 18:63278603-63278625 GGGATTTATAGTCAAGCAGCAGG - Intronic
1159620513 18:70632540-70632562 GAGATTTATAGCCAAGGAGGAGG - Intronic
1160203058 18:76810901-76810923 GGTATTTATAGCTAAGGAGAAGG - Intronic
1160322346 18:77907900-77907922 GGGTGTAATAGCCCTGGAGTGGG + Intergenic
1160457521 18:79013496-79013518 GGTCTTTTTAGCCATGGAGAAGG + Intergenic
1161615316 19:5266926-5266948 GGCATTTAGAGCAAGGGAGTTGG - Intronic
1162461619 19:10817196-10817218 GACATTTACAGCCATGGGGTGGG + Intronic
1163459683 19:17429549-17429571 GGGATTTATAGCCACGGAGCAGG + Intronic
1164253230 19:23503278-23503300 TGCATTTATAGCCATGCAGTAGG + Intergenic
1164667712 19:30052437-30052459 GGGATTTATTCTCATGCAGTGGG + Intergenic
1165682728 19:37791312-37791334 GGAATTTATAGTCAAGGAGCAGG + Intronic
1167308136 19:48720468-48720490 GGTATTTATAGCCACGGCCTTGG - Intergenic
1168161792 19:54515308-54515330 GGAATTTGTAGCCTTGGAGCAGG + Intergenic
925748729 2:7068033-7068055 GGAATTTATATCCAAGGAGCAGG - Intronic
925840934 2:7991334-7991356 GGGATTTGAAGAAATGGAGTAGG - Intergenic
926766857 2:16329795-16329817 GGGATTCTTAGCCATTGAGCTGG - Intergenic
926787854 2:16536256-16536278 GGAATTTATAGTCAAGGAGCAGG + Intergenic
927213935 2:20655626-20655648 GGAATTTATAGCCAAGGAACAGG + Intergenic
927597607 2:24410404-24410426 GTGAAGTATAGCCATTGAGTAGG + Intergenic
928552299 2:32384559-32384581 GGGATTCCTAGTCATGGACTAGG - Intronic
930176279 2:48304537-48304559 GGAATTTATAGCCAAGGAGCAGG - Intergenic
930304890 2:49665580-49665602 GGTATGTTTAGCCATGGGGTGGG + Intergenic
930444500 2:51452659-51452681 GGAATTTATAGCCAAGGAGTAGG - Intergenic
931057190 2:58485820-58485842 GGAGTTTATAGACAAGGAGTAGG + Intergenic
931824933 2:65990523-65990545 GGAATTTGTAGCCAAGGAGTGGG - Intergenic
932169823 2:69543959-69543981 AGGAATTATAGCCTTAGAGTAGG + Intronic
932252918 2:70259777-70259799 TGGAATTACAGCCATGGGGTGGG + Intronic
933293280 2:80461387-80461409 GCAATTTATAGCTAAGGAGTAGG - Intronic
934103658 2:88676803-88676825 GGGATTTATAATCAAGGAGCAGG - Intergenic
934700360 2:96434749-96434771 GGAATTTATAGTCAAGGAGCAGG - Intergenic
935723888 2:106006442-106006464 AGAATTTATAGCCAAGGAGGAGG + Intergenic
935949178 2:108313334-108313356 GGAATTTATAGCCATGCAGAAGG + Intergenic
936111741 2:109670761-109670783 GGGATCTCTGGGCATGGAGTTGG + Intergenic
936928606 2:117763496-117763518 AGGATTTATAGCCAAGAAGCAGG + Intergenic
937667140 2:124500402-124500424 GGGATTTATAGCCAAGGAGTAGG + Intronic
937874548 2:126811858-126811880 GGAATTTATAACCAAGGAGCAGG - Intergenic
938853007 2:135281080-135281102 GAGATTTATAGCCAGCAAGTAGG - Intronic
939739827 2:145892801-145892823 GGGTTTAATAGCCAAGCAGTAGG + Intergenic
939994496 2:148907398-148907420 TGGATTTATGGCCATGGAAAGGG + Intronic
940898039 2:159099807-159099829 GGAATTTATAGCCAAGGAACAGG - Intronic
942344984 2:174993248-174993270 GGAATTTATAACCATGAAGCAGG - Intronic
942597680 2:177607865-177607887 GGAATTTATAGCCAAGGAGCAGG + Intergenic
942682031 2:178487070-178487092 GGAATTTATAGCCAAGGAGCAGG + Intronic
943374667 2:187061543-187061565 GGGATTTATAGCCAAGAAGCAGG + Intergenic
944835448 2:203574771-203574793 TGGATTTAAAGCCATGCATTTGG + Intergenic
945067868 2:205962210-205962232 GGAATTTATAGCCCAGGAGCAGG - Intergenic
945253848 2:207787673-207787695 GAGATTTACAGCCAAGGAGCAGG + Intergenic
945293793 2:208150669-208150691 GGGATTTACAACCTAGGAGTGGG + Intergenic
945303022 2:208231907-208231929 GGAATTTATAGCCAAGGAGCAGG - Intergenic
945356012 2:208840744-208840766 GGAATTTATAGCCAGGGAGCAGG + Intronic
945930841 2:215853479-215853501 GGGATTTATAGCCCAGGAGCAGG + Intergenic
946015961 2:216604225-216604247 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
946366667 2:219253151-219253173 GGTATTTATAGCCCAGGAGCGGG - Intronic
946891030 2:224276584-224276606 GAGAATTATAGTCATGGAGAAGG - Intergenic
947445106 2:230157217-230157239 GGGATTTATAGCCATGGAGCAGG - Intergenic
948433499 2:237936012-237936034 GGGACTTGTAGCCAAGGAGCAGG - Intergenic
1168900630 20:1361572-1361594 GGCATTTTTAGCCATTGCGTGGG + Intronic
1169417211 20:5427525-5427547 GGGATTTATAAAGATGTAGTAGG + Intergenic
1170233319 20:14074159-14074181 GGAATTTATAGCCAAGGGGCAGG - Intronic
1170233986 20:14081281-14081303 GGGATTTATAGCCAAGGAGCAGG - Intronic
1170528476 20:17265329-17265351 GGGATTTATACCCAAAGAATAGG + Intronic
1170816467 20:19718866-19718888 GGTATTTAAAGCCCTGCAGTTGG + Intronic
1171273243 20:23832734-23832756 CGGATTTATAGCCAAGGATCAGG - Intergenic
1171279582 20:23884413-23884435 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1171284662 20:23927013-23927035 AGGATATATAGCCAAGGAGCAGG - Intergenic
1171452403 20:25245500-25245522 GGCATTTATAGCCAAGGACTGGG + Intergenic
1172254033 20:33501140-33501162 TGAATTTATAGCTTTGGAGTTGG + Intronic
1172860213 20:38043707-38043729 AGGATTTATAGGCGTTGAGTGGG + Intronic
1173447660 20:43134534-43134556 GAGATTTATAGCCAAGGAGCAGG - Intronic
1173484425 20:43429998-43430020 GAGATTTATCGCCAAGGAGCAGG + Intergenic
1173523687 20:43716707-43716729 AGTATTAATAGCCATGGGGTTGG + Intergenic
1174075700 20:47934472-47934494 TGGGTTTATAGCCAAGGAGCAGG + Intergenic
1176263962 20:64198933-64198955 GGCATTTACAGCCCTGGAGGAGG - Intronic
1177292879 21:19138294-19138316 AGAATTTATAGCCAAGGAGCAGG + Intergenic
1177403440 21:20636184-20636206 GGAATTTATAGCCAAGGAGCAGG + Intergenic
1178058685 21:28828229-28828251 GGGTTTTAAACCCTTGGAGTTGG - Intergenic
1178346455 21:31832612-31832634 GGGATTTATAGCCAGTGAGCAGG - Intergenic
1179595853 21:42442768-42442790 GGGAGTTATAGCCACAGAGCAGG + Intronic
1182006583 22:26965210-26965232 GGGATTTATAGCCAATGGGCAGG + Intergenic
1182077496 22:27504935-27504957 GGGCTTTGCAGCAATGGAGTGGG - Intergenic
1182273532 22:29170798-29170820 GGGATTGATCGCCAAGGAGCAGG + Intergenic
1184870722 22:47236389-47236411 GGGTTTTATAGGCATGAAGGTGG + Intergenic
1184950843 22:47841708-47841730 GGGATTCACAGCCAGGGAGGAGG + Intergenic
1184965189 22:47966292-47966314 GGGATTAGTAGCCAAGGAGAAGG - Intergenic
1185405292 22:50644741-50644763 GGAGTTTATAGCCAAGGAGCAGG - Intergenic
949143573 3:666366-666388 GGGATTTAGACCCAGGCAGTGGG - Intergenic
949234322 3:1790309-1790331 GGTATTAAAAGCCATGCAGTAGG + Intergenic
950119826 3:10474419-10474441 GGTATTTAAAGCCATGGGATGGG + Intronic
950305837 3:11914930-11914952 GGGACTGACAGCCATGGAGACGG + Intergenic
950794772 3:15501851-15501873 GGGAATTATAGCCAAGAAGCAGG - Intronic
951089248 3:18552987-18553009 TGGATTTACTGCCATGAAGTAGG - Intergenic
951711354 3:25587016-25587038 GGGATTTGAATCCAGGGAGTTGG - Intronic
952027900 3:29105666-29105688 GGGATTTAAAGCCATGCCATCGG - Intergenic
952170771 3:30804678-30804700 GGGATTCATAGCCAAGGGGCAGG - Intronic
952422502 3:33144693-33144715 GGCATTTAAAGCCATGCAGCTGG + Exonic
952675360 3:36023431-36023453 GGGATTTATAGCCAACAAGCCGG - Intergenic
953423353 3:42772352-42772374 AGGACTTAGAGCCAGGGAGTAGG + Intronic
955256006 3:57332019-57332041 GGGATTTATAGTCAAGGAGCAGG - Intronic
956319055 3:67975022-67975044 GGGCTTTATAACCATGAAATGGG - Intergenic
956687121 3:71840420-71840442 GGAATTTATGGCCAAGGAGCAGG + Intergenic
957767149 3:84639923-84639945 GAGATTTATAGCCAAGGAGCAGG + Intergenic
957931800 3:86888250-86888272 GGGATTTACAGCTAAGAAGTAGG + Intergenic
958457666 3:94352012-94352034 GAGATCTATTGCCCTGGAGTGGG + Intergenic
958520213 3:95175677-95175699 GAAATTTATACCCAAGGAGTAGG - Intergenic
958772210 3:98438313-98438335 GGGATTTGTAGCCAAGGAACAGG + Intergenic
959051609 3:101529592-101529614 GGAATTTATAGCCAAGTAGTAGG - Intergenic
959267185 3:104157382-104157404 TAGATTCATAGCCATGGAGTGGG + Intergenic
959770565 3:110090314-110090336 GGGATTTATAGCCAAGGAGCAGG + Intergenic
959980938 3:112516796-112516818 GGAATTTATAGCCAAGGAGCAGG - Intergenic
960984631 3:123268035-123268057 GGGATTCATTGCCATCTAGTGGG + Intronic
962322656 3:134404656-134404678 GGTATTTAAAGCCATGGGGATGG + Intergenic
962732074 3:138292753-138292775 GGTATTTAAAGCCATGGAGCTGG + Intronic
963343299 3:144063681-144063703 GAGATTTATAGGCAAGGAGAAGG - Intergenic
963469451 3:145721605-145721627 GGAATTTATAGCCGAGGAGCAGG - Intergenic
964546091 3:157835272-157835294 GGAATTTATAGCAAAGGAGCAGG - Intergenic
965587029 3:170327758-170327780 GGGATCTAGCGCCATGGAGCAGG - Intergenic
965935736 3:174108612-174108634 GAGATTTATAGCCAAGGAACAGG + Intronic
966221521 3:177556495-177556517 GGGATTTATAGCCAAGAAGCAGG + Intergenic
966420408 3:179729168-179729190 GGGATTTATAAACAAGGAGTTGG + Intronic
966955698 3:184876043-184876065 AGAATTTATAGACATGGAATAGG - Intronic
969348027 4:6581384-6581406 GGGATTTATATATATGCAGTAGG + Intronic
969661773 4:8534220-8534242 GGGGTTTAGTGCCCTGGAGTTGG + Intergenic
969907794 4:10413491-10413513 GGGATGTTTTCCCATGGAGTGGG + Intergenic
970764192 4:19527206-19527228 GGAATTTATAGCCAAGGAGCAGG + Intergenic
971390893 4:26184358-26184380 GGGATTGACAGCCAGGGAGCAGG + Intronic
971680918 4:29699671-29699693 GGAATTTATAGCCAAGAAGCAGG + Intergenic
971691801 4:29846342-29846364 GAAATTTATAGCCAAGGAGCAGG + Intergenic
972228580 4:37043743-37043765 GGGATTTATAGCCAAGGAGCAGG + Intergenic
972694422 4:41431285-41431307 AGGATCTATAGACATAGAGTTGG + Intronic
972875438 4:43352890-43352912 GGGATGCATAGCCAAGGAGCAGG - Intergenic
973117130 4:46475801-46475823 GGGATTTGTAGCCAAGGATCAGG - Intergenic
975881064 4:78908567-78908589 GGGAGTTATCACCATGCAGTTGG - Intronic
976194844 4:82522749-82522771 GGAATCTATAGCCAAGGAGCTGG + Intronic
976287111 4:83381424-83381446 GGAATTTAGAGCCAAGGAGCAGG - Intergenic
976436385 4:85023384-85023406 AGGATTTATAGTCAAGGAGCAGG + Intergenic
978885923 4:113766329-113766351 GGAATTTATATCTAAGGAGTGGG + Intergenic
980132188 4:128827099-128827121 GAGATTTATAACCAAGGAGGAGG - Intronic
980933056 4:139199668-139199690 GAAATTTATAGCCAAGGAGAAGG - Intergenic
981915117 4:150024842-150024864 GGAATTTATAGCCAAGGAGCAGG + Intergenic
984279368 4:177650356-177650378 GAAATTTATAGCCAAGGAGCAGG - Intergenic
986817237 5:11426082-11426104 GGAATTTATAGCCAAGGAGGAGG - Intronic
987027568 5:13942766-13942788 AGGATTTGTAGCCAAGGAGCAGG - Intronic
987569481 5:19637781-19637803 GGAATTTATATCCAAGGAGTTGG - Intronic
988422604 5:31024430-31024452 GGAATTTATAGCCAAGGAGCAGG - Intergenic
988672420 5:33396236-33396258 GGAATTTACAGCCAAGGAGCAGG + Intergenic
988890589 5:35612525-35612547 GGGATTTATAGCCAAAGAGCAGG + Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
990410483 5:55535752-55535774 GGGATTTATAGCCAAGGAACAGG - Intergenic
991069517 5:62461191-62461213 GGAATTTATTGCCAAGGAGCAGG + Intronic
991718033 5:69469971-69469993 GGCATTTACACCCATGAAGTAGG - Intergenic
992262380 5:74984480-74984502 GAAATTTATAGCCAAGGAGGAGG + Intergenic
992288655 5:75262273-75262295 GGCATTTATAGCCAAGGAGCAGG - Intergenic
992466945 5:77015515-77015537 GAGATTTACAGCCAAGGAGCAGG - Intergenic
995898705 5:117044719-117044741 GGAATTTATAGCCAAGGAGCAGG - Intergenic
996787542 5:127256529-127256551 GGGATTTATGACCATGGAGCAGG - Intergenic
997472483 5:134124596-134124618 GGGAGTTCTAGCTATGGAGTTGG - Intronic
997835293 5:137187163-137187185 GGTATTTGTAGCCATGGAGTGGG - Intronic
999642169 5:153682677-153682699 GGAATATATAGCCAAGGAGCAGG - Intronic
1000097432 5:157984303-157984325 GGAATTTATAGCCAAGGAACAGG + Intergenic
1000299252 5:159940495-159940517 GGAATTTATGGCCAAGGAGCAGG - Intronic
1000338839 5:160261550-160261572 GGGATTTCCAGCCATGCAGGAGG - Intronic
1001117621 5:168952889-168952911 GGGGTTTATAGCCAAAGAGCAGG + Intronic
1001449939 5:171816905-171816927 GGGATTTATAGGCAAGGAGCAGG - Intergenic
1002104902 5:176875188-176875210 GGCGATTAAAGCCATGGAGTGGG - Intronic
1002875263 6:1204380-1204402 GGGATTTATAGTAAAGGAGCAGG + Intergenic
1003070266 6:2939928-2939950 GGGACTGGGAGCCATGGAGTAGG - Intergenic
1003075770 6:2982668-2982690 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1004450243 6:15738747-15738769 GAGATTTATAGCCAAGGAGCAGG - Intergenic
1004450757 6:15743530-15743552 GAGATTTATAGCCAAGGAGTTGG - Intergenic
1004458324 6:15812353-15812375 TGAATTTATAGCCATGGAAGGGG + Intergenic
1005577686 6:27205336-27205358 GGAATTTATAGCCAAGGATCGGG - Intergenic
1006605350 6:35252246-35252268 GGGATTTCTAGGCCTGGAGCAGG - Exonic
1008157602 6:48035862-48035884 CGAATTTATAGCCAAGGAGCAGG - Intronic
1008806935 6:55441127-55441149 AGAATTTATAGCCAAGGAGTGGG + Intronic
1008856938 6:56099833-56099855 GGTATTAATAAGCATGGAGTGGG - Intronic
1008976109 6:57429239-57429261 GATATTTATAGCCAAGGAGCAGG + Intronic
1009164639 6:60326381-60326403 GATATTTATAGCCAAGGAGCAGG + Intergenic
1009380787 6:63026288-63026310 TGGATTTATAACCAAGGAGCAGG + Intergenic
1009474852 6:64077717-64077739 GGGATATATTACCATGCAGTTGG - Intronic
1010300337 6:74252745-74252767 GGGATTTATAGCCAAAGAGCAGG + Intergenic
1010504035 6:76634038-76634060 GGTTTTTATAGGCACGGAGTGGG + Intergenic
1010578724 6:77566854-77566876 GGAATTTATAGCCAGGGAGAAGG - Intergenic
1010917514 6:81638651-81638673 GGAATTTATAGCCAAGGAGCAGG - Intronic
1011053312 6:83177936-83177958 GGGCTTTATAGCCAAGGAGCAGG - Intronic
1011417124 6:87133518-87133540 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1011926304 6:92649636-92649658 GGGATGTATAGCAAAGGAATAGG - Intergenic
1012438855 6:99243491-99243513 GGGATTGGGAGCCATGTAGTGGG - Intergenic
1012531562 6:100244204-100244226 GGGATTTATAGCAATGGTGAAGG - Intergenic
1013744555 6:113329983-113330005 GGAATTTATAGCCAAGGAGTAGG - Intergenic
1013962052 6:115912246-115912268 GGAATTTATAGCCAAGGAACAGG + Intergenic
1014450675 6:121577941-121577963 GAGATTTATAACCAAGGAGCAGG + Intergenic
1016009729 6:139126892-139126914 GGGATTTGTAGCCAAGGAGCAGG + Intergenic
1016291318 6:142531255-142531277 AGTATTTAAAGCCATGGAATTGG - Intergenic
1016443500 6:144109085-144109107 GGAATTTATAACCAAGGAGCAGG + Intergenic
1017303328 6:152887583-152887605 GAGATTTCTAGCCAAGGAGTTGG - Intergenic
1017574133 6:155782610-155782632 GGGATTTATAGCCAAGGAGCAGG - Intergenic
1018554053 6:165032695-165032717 GGAATTTATAGCCACAGAGCAGG - Intergenic
1020904987 7:14053354-14053376 GAGCTTTATAGGCATGGAGAGGG - Intergenic
1021212488 7:17871691-17871713 GGGATTTATAGCCAAGGAGCAGG - Intronic
1022159551 7:27695512-27695534 GGAATTTATAGCCAAGAAGCAGG + Intergenic
1022574248 7:31482366-31482388 GAGATTTATAGCCAGGGAGCAGG - Intergenic
1022660137 7:32359226-32359248 GGGATTTATAACCAAGGAGCAGG - Intergenic
1024718621 7:52108891-52108913 GGGACTTATTTTCATGGAGTTGG - Intergenic
1024813097 7:53236171-53236193 GGGATATACAGCCAAGGAGCAGG - Intergenic
1027607438 7:80317767-80317789 AGAATTTATAGCCAAGGAGCAGG - Intergenic
1027620992 7:80484843-80484865 AGGACCTATAGCCAAGGAGTAGG - Intronic
1027671553 7:81105669-81105691 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1028344044 7:89758543-89758565 GGGCTTTATAGTCAAGGAGCAGG + Intergenic
1029275849 7:99403940-99403962 GGGATGACTTGCCATGGAGTGGG - Intronic
1029354863 7:100044228-100044250 GCAATTTATAGCCAAGGAGCAGG - Intergenic
1030085422 7:105811630-105811652 TGCATTTATAGCCATGGGGCTGG + Intronic
1031007593 7:116491383-116491405 GGTATTTATAGCCATTAAATTGG + Intronic
1031062471 7:117067468-117067490 GGGTTTTATAGCCAGGGAGCAGG + Intronic
1031251635 7:119390325-119390347 GGGATGTGTAGCCTTGGAGAAGG + Intergenic
1031449323 7:121894893-121894915 GGGATTTATAACTATGGAAGTGG + Intronic
1032634260 7:133689443-133689465 GAGATTTATAGCCAAGGATATGG + Intronic
1032783503 7:135183051-135183073 GGAATTCATAGCCAAGGAGCAGG - Intergenic
1034211750 7:149369763-149369785 GGTATTTATAGCCAAGGAGCAGG - Intergenic
1034761025 7:153671893-153671915 ACGTTTTATAGACATGGAGTTGG - Intergenic
1035555285 8:563039-563061 GGAATCTATAGCCAAGGAGCAGG + Intergenic
1035589973 8:805258-805280 AGGATATATGGTCATGGAGTTGG - Intergenic
1036436907 8:8743090-8743112 GGGGTTTAGTGCCAAGGAGTGGG - Intergenic
1037631430 8:20660287-20660309 GGGATTTAAAGCCATAGGATAGG - Intergenic
1038058480 8:23885329-23885351 GAAATTTCTAGACATGGAGTAGG - Intergenic
1038865128 8:31431233-31431255 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1039729021 8:40254729-40254751 GGAATTTATAGTCAAGGATTAGG - Intergenic
1040489907 8:47910235-47910257 GGGATTGATAGCCAAGGAGCAGG - Intronic
1040676498 8:49757107-49757129 GGGATTTACAGCCAAGGAGCAGG - Intergenic
1040852998 8:51921446-51921468 GGAGTTGATAGCCAAGGAGTAGG + Intergenic
1042341548 8:67684961-67684983 GGAATGTATAGCCAAGGAGCAGG - Intronic
1045965101 8:108015726-108015748 GAGATTTATACACAAGGAGTGGG - Intronic
1046726954 8:117686201-117686223 GGGATTTGAACCCATGTAGTTGG + Intergenic
1047502851 8:125455260-125455282 CGGATTTACAGGCCTGGAGTTGG - Intergenic
1048413726 8:134203115-134203137 GGGATTTAAAACCATGATGTAGG + Intergenic
1048519915 8:135143881-135143903 GAGATTTATAGCCAACAAGTAGG - Intergenic
1048949430 8:139483153-139483175 AGAATTTATAGCCAAGGAGCAGG + Intergenic
1050265729 9:3887613-3887635 TGGATTTATAGCCAGGGAAGAGG + Intronic
1050418744 9:5440446-5440468 GGGATTTATAGCCGAGGAGCAGG + Intergenic
1051190641 9:14508363-14508385 GGGATATATGGACAAGGAGTGGG - Intergenic
1052255590 9:26452557-26452579 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1053140925 9:35682238-35682260 GTGACATATAGACATGGAGTGGG + Intronic
1053185345 9:36011718-36011740 GGAATTTTTAGCCAAGGAGGGGG + Intergenic
1055037089 9:71829293-71829315 GAGATTTACAACCAAGGAGTAGG + Intergenic
1055067199 9:72130953-72130975 GGGATGTATACCCATGGAAGAGG + Intronic
1055577014 9:77670659-77670681 GGGATTTATAGCCAAAGAAAAGG + Intergenic
1055713742 9:79094290-79094312 GGGATTTATAGCCAAGGAACAGG + Intergenic
1055953818 9:81755468-81755490 GGGACTTATAGCCAAGGAGCAGG - Intergenic
1056046848 9:82727265-82727287 GGGAATCATAGTCATGGTGTTGG - Intergenic
1056139150 9:83657658-83657680 GTGATTAATAGTTATGGAGTTGG - Intergenic
1056740375 9:89249481-89249503 GGAGTTTATAGCCAAGGAGCAGG + Intergenic
1056846156 9:90039926-90039948 GGAATTTATCACCAAGGAGTAGG + Intergenic
1057377065 9:94534830-94534852 GGCATTTATAGCCAAGGAGCAGG - Intergenic
1057647952 9:96894537-96894559 GGAATTTATTGCCAAGGAGTAGG - Intergenic
1057866695 9:98687218-98687240 GGGATTTACAGCCAAGGGGCAGG + Intronic
1058186400 9:101860545-101860567 TGGATTTATAGTTAAGGAGTAGG - Intergenic
1058328286 9:103725898-103725920 GGAATTTATAGCTAAGAAGTAGG + Intergenic
1058537566 9:105977895-105977917 GGGATTTATAACCGAGGAGCAGG + Intergenic
1059306955 9:113361167-113361189 GGAATTTATAGCTAAGGAGCAGG - Intronic
1059826373 9:118033764-118033786 GAGATTTATAGCTAAGGAGTAGG - Intergenic
1060778735 9:126395995-126396017 GTGCTGTATAGCCATGGGGTTGG + Intronic
1062191502 9:135250118-135250140 GGGATTTACAGCCGAGGAGCCGG + Intergenic
1185986855 X:4844747-4844769 GGGATTTATAGCCGGGGAGCAGG - Intergenic
1186207656 X:7217041-7217063 GGGATTCATAGCCACGGAATAGG + Intergenic
1186221514 X:7354270-7354292 GGGATTTATAGACAGGGAACAGG - Exonic
1186527642 X:10264112-10264134 GGGATTTAGAGCCATGTAGATGG + Intergenic
1186533079 X:10317043-10317065 GAGATTTATAGCCAAGGAGCAGG - Intergenic
1186550283 X:10497582-10497604 GGGATTTACAGCCAAGGAGCAGG - Intronic
1187827473 X:23346377-23346399 GGAATTTATAGCCAAGGAGCAGG + Intronic
1188495696 X:30780845-30780867 GGAATGTATAGCCAAGGAGCAGG - Intergenic
1188539597 X:31234861-31234883 GGAATTGATAGCCAAGGAGCAGG + Intronic
1188933764 X:36148120-36148142 GGAATTTACAGCCAAGGAGCAGG + Intergenic
1189078503 X:37943438-37943460 GGGATTTACAACCAAGGAGCAGG + Intronic
1189967572 X:46390374-46390396 GGAATTTATTGCCAGGGAGCAGG - Intergenic
1190175591 X:48146467-48146489 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1190182497 X:48205031-48205053 GGGATTTATAGTCAAGGAGTAGG + Intronic
1190182879 X:48208359-48208381 GGGATTTGTAGTCAAGGAGTAGG - Intronic
1190186355 X:48238011-48238033 GGGATTTGTAGTCAGGGAGTAGG - Intronic
1190192317 X:48287683-48287705 GGGATTTGTAGTCAGGGAGTAGG + Intergenic
1190195752 X:48316961-48316983 GGGATTTGTAGTCAGGGAGTAGG - Intergenic
1190201728 X:48367554-48367576 GGGATTTGTAGTCAGGGAGTAGG + Intergenic
1190208811 X:48427857-48427879 GGGATTTGTAGTCAGGGAGTAGG - Intergenic
1190662454 X:52667324-52667346 GGGATTTGTAGTCAGGGAGTAGG - Intronic
1190668566 X:52718091-52718113 GGGATTTGTAGTCAAGGAGTAGG + Intergenic
1190670851 X:52740313-52740335 GGGATTTGTAGTCAAGGAGTAGG - Intergenic
1190952821 X:55162662-55162684 GAAATTTATAGCCAAGGAGCAGG - Intronic
1191764963 X:64688087-64688109 GAGATTTACAGCCAAGGAGCAGG - Intergenic
1193024372 X:76829337-76829359 GAGATTTATAGCCAAGAAGCAGG - Intergenic
1193801500 X:85942282-85942304 GGGATTTAAAGACTTGGGGTTGG - Intronic
1194712634 X:97253931-97253953 GGGATTTATAGCCAAGAAGCAGG + Intronic
1196078184 X:111600598-111600620 GGAATTTATAGCCAAGAAGCAGG - Intergenic
1196140288 X:112253957-112253979 GGGATTTATAGCCAAGGATCAGG - Intergenic
1196779926 X:119374798-119374820 GGTATTTATAGCCCTGGAACTGG + Intergenic
1197995523 X:132368370-132368392 GGAATTTATAGCCAAGGAGCAGG - Intergenic
1198453677 X:136793894-136793916 GGGATTTACTGCCATGAAGCTGG - Intergenic
1199936570 X:152580159-152580181 GGGATTTATAATCAGGGAGCAGG - Intergenic
1200403585 Y:2785347-2785369 GGGATTTATAGCCAAGGAGCAGG + Intergenic
1201099792 Y:10662839-10662861 GGAATTTAAAGGAATGGAGTGGG - Intergenic
1201128453 Y:10934629-10934651 GGAATTTATTGAAATGGAGTGGG - Intergenic
1201579481 Y:15495712-15495734 GGGATTCATATCCATGGAGTAGG + Intergenic
1201589687 Y:15601355-15601377 GGGATTCATAGCCAGGGAGCAGG - Intergenic