ID: 1098836088

View in Genome Browser
Species Human (GRCh38)
Location 12:75425707-75425729
Sequence GTGTCTAAGCAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 1, 2: 4, 3: 33, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098836085_1098836088 11 Left 1098836085 12:75425673-75425695 CCTGACATCACTTATTTTTATTT 0: 1
1: 0
2: 6
3: 117
4: 1082
Right 1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG 0: 1
1: 1
2: 4
3: 33
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098836088 Original CRISPR GTGTCTAAGCAGAGTGAGGA GGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900893894 1:5469589-5469611 GTGCCCACGCAGATTGAGGATGG - Intergenic
901124066 1:6917022-6917044 GTGTCTAAGCTGAGACATGAAGG + Intronic
902470003 1:16642725-16642747 CTGGCCCAGCAGAGTGAGGAGGG + Intergenic
902546025 1:17190824-17190846 GTGTAGCAGCAGCGTGAGGAAGG - Intergenic
903116298 1:21181225-21181247 TTGGCTAAGGGGAGTGAGGACGG - Intergenic
904712971 1:32444891-32444913 CAGTCTGAGCAGAGTCAGGAGGG + Intergenic
905014236 1:34766227-34766249 GAGTCTAAGCTGAGAAAGGAGGG - Intronic
905042674 1:34973193-34973215 GAGTCAACGCAGAGGGAGGAGGG + Intergenic
905106528 1:35566342-35566364 GTGTTGCAGCAGAGTGACGATGG + Exonic
905262515 1:36729763-36729785 GTGTCCAAGCAGTGGGATGAGGG + Intergenic
905329154 1:37180031-37180053 GTGGCTGAGCAGAGTGATGGAGG - Intergenic
905366251 1:37453258-37453280 GATTCCTAGCAGAGTGAGGAGGG + Intergenic
905461952 1:38127870-38127892 CAGTCAAAGCAGAGTGAAGAAGG - Intergenic
905545195 1:38792251-38792273 GTGTTTGAGCAGAGACAGGATGG - Intergenic
906654949 1:47541400-47541422 GTGTCCAAGTAGAGTTAGAAGGG + Intergenic
907106682 1:51889305-51889327 GAATCCAAGCAGAGTGAGGAGGG + Intergenic
907477470 1:54715272-54715294 GGGCTGAAGCAGAGTGAGGAAGG - Intronic
907479657 1:54736751-54736773 GAGTCCAAGTAGGGTGAGGAAGG - Intronic
907948330 1:59156147-59156169 GTTTTTAAGCACAGAGAGGATGG + Intergenic
908313606 1:62910570-62910592 GTGGCTAAGCAAAGTGACTAGGG - Intergenic
909340745 1:74528282-74528304 GAGCCTGAGCAGGGTGAGGAGGG + Intronic
909804969 1:79863113-79863135 TTGTCTAAGATGAGAGAGGATGG + Intergenic
909916313 1:81324016-81324038 GAATTTAAGCAGAGTGAGGCAGG + Intronic
910231726 1:84994875-84994897 GTGATTAAGCTTAGTGAGGAAGG - Intronic
911233081 1:95380955-95380977 GTGTCTACCCAGATTGAGGGTGG + Intergenic
912672989 1:111648750-111648772 TGGTCTCAGCAGATTGAGGAGGG - Intronic
915109850 1:153556419-153556441 TTGGCTAAGTAGAGGGAGGAAGG + Intergenic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916076036 1:161200497-161200519 GTGACAAAGCAGAGTGAATAGGG - Intronic
916150803 1:161787488-161787510 GAGTCACAGCAGAGTGAGGAGGG - Intronic
916239678 1:162626403-162626425 GTGTCCAAGCAGAGTGAACTTGG - Intergenic
917250428 1:173053639-173053661 CTGTTTAAGAAGAGAGAGGAGGG + Intergenic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
917872835 1:179257073-179257095 GTGTCTAAGTAAATTGAAGACGG - Intergenic
918681266 1:187357556-187357578 GTATCTTAGCAGAGTGAGAATGG - Intergenic
920141108 1:203814118-203814140 ATTTCTAAGCAAAGTGTGGAAGG - Intronic
920180518 1:204129455-204129477 GTGTCTCAGCAGAGGGAATAAGG - Intergenic
920213503 1:204345795-204345817 GTGACTCAGCAGAGAAAGGAGGG - Intronic
920419335 1:205820474-205820496 TTGACTAAGCAGGGAGAGGAGGG - Intergenic
920903146 1:210132363-210132385 ATGTCCAAGCAGGGTGAGGAGGG - Intronic
921628885 1:217409776-217409798 GGGTATAACCAGAGTGGGGATGG - Intergenic
922388055 1:225108049-225108071 GTGTCTACCCAGATTGAGGGTGG - Intronic
923058621 1:230449259-230449281 GTGTCCAAACAGAGTGAAGAGGG - Intergenic
1063064174 10:2591707-2591729 ATGTCTTAGCAGTGTGAGAACGG + Intergenic
1064580376 10:16787389-16787411 GGGCCCAGGCAGAGTGAGGAGGG - Intronic
1064676606 10:17766219-17766241 GTTTCTAAGCAAAGTGTTGAAGG - Intronic
1064961501 10:20970167-20970189 TTGTGTGAGCAGAGCGAGGATGG + Intronic
1065309111 10:24396983-24397005 GAGTGTTAGCAGAGTGAGCAGGG + Intronic
1065341424 10:24710375-24710397 GTGTCTAAGCTAACTGAGGAAGG - Intronic
1065598557 10:27344630-27344652 GTGTCTAAACATAGACAGGAGGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067204054 10:44198666-44198688 GTGTGTGGGCAGAGTGGGGAGGG + Intergenic
1068329911 10:55549735-55549757 GTCTCTAAACAGATTGAGTAGGG + Intronic
1069290390 10:66772005-66772027 GTGTGTAAGGAGAGTGAGTGGGG + Intronic
1071369977 10:84941230-84941252 GTGTCTAAGAGGAGAGAGGAAGG + Intergenic
1071805840 10:89119893-89119915 GAGTGAAAGGAGAGTGAGGAGGG - Intergenic
1074649848 10:115508424-115508446 GTGATTAAGCTTAGTGAGGAGGG + Intronic
1074671373 10:115796008-115796030 GTGCCCAGGCAGAGTGAGGAGGG - Intronic
1075649404 10:124117742-124117764 GTCTCAAAGCTGAGTGAGGCTGG - Intergenic
1076276398 10:129202952-129202974 GTGATTAAGCTGAGTAAGGAAGG - Intergenic
1076640024 10:131909087-131909109 GGGTATAAGAAGAGGGAGGAAGG + Intronic
1076734818 10:132453901-132453923 ATGGCTAAGCTGAGTGAGGCAGG + Intergenic
1076998096 11:308877-308899 GAGTCTGAGCCGGGTGAGGAAGG + Intronic
1078090484 11:8261915-8261937 GTGTGTAGGAAGAGAGAGGATGG - Intronic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1084563371 11:69916226-69916248 GGGTCTGGGCAGAGTGAGGCTGG + Intergenic
1085077137 11:73601222-73601244 GAGTCTAACTAGAGTGAGGTGGG - Intergenic
1085104335 11:73829269-73829291 GTGAGAAAGCAGGGTGAGGAGGG + Intronic
1085239770 11:75043624-75043646 TAGTCTGAGCAGAGTCAGGAGGG - Intergenic
1085395371 11:76204565-76204587 GTGTCCTAGCAGAGGGAGCATGG - Intronic
1086588385 11:88482624-88482646 ATGTTTAGGCAGATTGAGGAGGG + Intergenic
1086859905 11:91913610-91913632 GCATGTAAGCTGAGTGAGGAAGG + Intergenic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1088517950 11:110658923-110658945 GTGATTAAGCAGAGTGAGGAGGG - Intronic
1089644488 11:119869660-119869682 AGGTCTAGGCAGAGAGAGGATGG - Intergenic
1091136550 11:133196089-133196111 GTGTCTTAGCAAATTGAAGAAGG + Intronic
1091227718 11:133967548-133967570 CGGTCTCAGCACAGTGAGGAGGG - Intergenic
1092395428 12:8121789-8121811 GAGTGCAAGCAGGGTGAGGAGGG + Intergenic
1092395539 12:8122367-8122389 GAGTGCAAGCAGAGTGAGGAGGG + Intergenic
1095379871 12:41577913-41577935 GTATCTGAGCACAATGAGGAAGG - Intergenic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1095860867 12:46916798-46916820 ATGTCTAAGCAAAGTGTTGAGGG + Intergenic
1095985456 12:47996328-47996350 GTGACTAAGAAGAATGAAGATGG - Intronic
1096013268 12:48241985-48242007 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1096645233 12:53030108-53030130 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1096645255 12:53030266-53030288 GTGTCTTAGGAGACTGAGGTAGG + Intronic
1096872055 12:54599138-54599160 GATTCTAAGCAGAGTGAACAAGG + Intergenic
1096973073 12:55682833-55682855 GGGATTAAGCAGAGTGTGGACGG + Intronic
1097237678 12:57550840-57550862 GGGTCTCTGCAGAGTGTGGATGG + Intronic
1098800675 12:74953434-74953456 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1098836088 12:75425707-75425729 GTGTCTAAGCAGAGTGAGGAGGG + Intronic
1098961307 12:76742369-76742391 GTGGCAAATCAGAGTTAGGAGGG + Intergenic
1099778386 12:87163559-87163581 ATTTCTAAGCAGAGTGTTGAAGG - Intergenic
1099941327 12:89192746-89192768 GTGGCTCAGCAGAGGGAGGAAGG + Intergenic
1100616641 12:96236186-96236208 GTGTTTAAGGAGAGCCAGGAGGG + Intronic
1101509394 12:105379390-105379412 GTGTTTAAGCTGAGGAAGGAGGG - Intronic
1104351451 12:128047693-128047715 AGTTCTAAGCACAGTGAGGATGG - Intergenic
1104352570 12:128057646-128057668 GAGTCCAAGGAGGGTGAGGAAGG + Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1105746995 13:23386713-23386735 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1107232584 13:38128262-38128284 GTGTGGGAGGAGAGTGAGGATGG - Intergenic
1107462614 13:40618497-40618519 TTGGCTAAGCCGAGTGATGAGGG + Intronic
1108010334 13:46000792-46000814 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1108231238 13:48344362-48344384 GAGTCAAAGTAGGGTGAGGAGGG + Intronic
1108278059 13:48831468-48831490 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1108293501 13:48987517-48987539 CTGACTAAGAAGGGTGAGGATGG + Intronic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108602301 13:52005330-52005352 ATATCTAAGCAGAGTGTGCAGGG - Intronic
1111366028 13:87246100-87246122 ATGACTAAGCTTAGTGAGGAAGG + Intergenic
1112835728 13:103512040-103512062 GAATCTAAGCAGAAAGAGGAGGG + Intergenic
1113095052 13:106654346-106654368 CTGTCAGAGCAGAGTGGGGAGGG + Intergenic
1115928100 14:38460138-38460160 GTGGCTGAGCAGAGAGAGCAAGG + Intergenic
1116445039 14:44999233-44999255 GTGTTTAAGTACAGTGAGGTAGG - Intronic
1116924907 14:50624656-50624678 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1118818696 14:69330684-69330706 GGGTGAAAGCAGAGTGGGGAAGG + Intronic
1119879714 14:78090657-78090679 GGGTCTAAGCAGTGGGAGGTTGG + Intergenic
1120442646 14:84559584-84559606 GTCTCTAAGCACAATGAAGAAGG + Intergenic
1120504560 14:85338675-85338697 GTGTCTTTGCAGAGTGAGGTGGG + Intergenic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121805092 14:96811565-96811587 GTCTCTAAGAAGAGTGAGTCAGG + Intronic
1122088269 14:99321784-99321806 GTGTCTTGGCACAGAGAGGAAGG - Intergenic
1122201305 14:100124237-100124259 CTGACAAAGCTGAGTGAGGAAGG - Intronic
1122469161 14:101954508-101954530 TTTTCTAAGTAGAGTGAGTAGGG - Intergenic
1122925633 14:104898204-104898226 TTGTCTAGTCAGAGTGAGGAGGG + Intergenic
1123205542 14:106709296-106709318 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1123482651 15:20647141-20647163 ATTTCTAAGCAAAGTGTGGATGG + Intergenic
1124397177 15:29312853-29312875 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1128305243 15:66594020-66594042 GTCTGAAAGCAGAGTGAGGATGG + Intronic
1128586277 15:68853002-68853024 GAGCCCGAGCAGAGTGAGGAGGG + Intronic
1128744322 15:70103021-70103043 GTGTCTATGCAGAATAAGGTTGG - Intergenic
1129304235 15:74647312-74647334 GTGCCTAGACAGAGTGAGAAAGG - Intronic
1129513849 15:76144514-76144536 GGCTCCATGCAGAGTGAGGAAGG + Intronic
1130636021 15:85620808-85620830 GTGTCTAAGCAGGATGAGGGCGG + Intronic
1130741586 15:86606285-86606307 GTTTCTAAGGAGATTGTGGAAGG - Intronic
1131023084 15:89116274-89116296 GTTTACAAGCACAGTGAGGACGG - Intronic
1132032394 15:98449413-98449435 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1132061367 15:98694859-98694881 GTGTGTAAGCAGTGCGTGGAAGG + Intronic
1133366855 16:5216949-5216971 GAGACTAAGCAGAGTGGGGTTGG + Intergenic
1133957337 16:10456134-10456156 GTTTCTAAGCAAAGTGTTGAAGG + Intronic
1133966804 16:10537603-10537625 GTGTCTCAATAGAGAGAGGAGGG - Intronic
1134827180 16:17294197-17294219 CTGACAAAGCAGAGTGGGGAAGG + Intronic
1135241497 16:20810801-20810823 GAGCCTAAGCAGAGTCAAGAGGG - Intronic
1138246871 16:55474145-55474167 ATGTCTAAGCTTAGTGAGAAAGG - Intronic
1140398983 16:74654641-74654663 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1140427331 16:74871844-74871866 GTGTCTCAGTAGCGTGAGCAGGG - Exonic
1141451813 16:84108692-84108714 GAGTCTGAGCGGAGTGAGGAAGG + Intronic
1142431227 16:90028964-90028986 GTGGCTAAGCAGAGAGGTGATGG + Exonic
1142907361 17:3053133-3053155 CTCTCTAAGCAAAGGGAGGAGGG - Intergenic
1142927202 17:3251108-3251130 CTCTCTAAGCAAAGGGAGGAGGG + Intergenic
1143542269 17:7576505-7576527 GTATCTGAGCAGAGAGAGGCAGG - Exonic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144673448 17:17146066-17146088 CTGACTAAGCAGTATGAGGACGG + Exonic
1144782911 17:17816830-17816852 GTGGCTAGGCACAGGGAGGACGG + Intronic
1144825060 17:18101116-18101138 GTGTGCAAGCAGAGGCAGGATGG + Intronic
1146043994 17:29486884-29486906 CTGTTTAAGCAGAGAGAAGATGG + Intronic
1146082029 17:29789133-29789155 GTTTCTAAGCAAAGTGGTGAAGG + Intronic
1146109544 17:30075714-30075736 GAGCCTGAGCAGAGCGAGGAGGG - Intronic
1146158388 17:30544010-30544032 ATGACTAAGGATAGTGAGGAAGG + Intergenic
1147412995 17:40267323-40267345 GAGCCTAAGCTGGGTGAGGAGGG + Intronic
1147671695 17:42180369-42180391 GTGTCTAAGGTGGGTGAGGCAGG - Intronic
1148759312 17:49991306-49991328 GTGTCTAGGCAGAGGGAGGGAGG + Exonic
1148801387 17:50228799-50228821 GAGCCTAAGAAGAGTAAGGAGGG - Intergenic
1150819254 17:68421896-68421918 GTGCCCATGCAGAGTGAGCAGGG + Exonic
1151783528 17:76263703-76263725 GAGTTTAAGCAGATTGGGGAAGG - Intergenic
1151949330 17:77341199-77341221 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1152194197 17:78907009-78907031 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1152228773 17:79104506-79104528 ATGTCCTAGCAGGGTGAGGAGGG - Intronic
1152902539 17:82951648-82951670 ATGTTTAAGCTTAGTGAGGAAGG - Intronic
1152933176 17:83120791-83120813 TTGTCTAACCAGAATGATGAGGG + Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153463974 18:5368215-5368237 GTGTGAAAGGAGAGGGAGGAAGG - Intergenic
1154939845 18:21100908-21100930 GTGACTAGTCACAGTGAGGAAGG - Intronic
1157606017 18:48926409-48926431 GGGTCAAAGGCGAGTGAGGACGG + Intronic
1158554177 18:58461472-58461494 GTGTGTAATGAGAGTGATGAGGG + Intergenic
1158575029 18:58629498-58629520 GGGGGTAAGCAGGGTGAGGAGGG - Intergenic
1159438280 18:68445972-68445994 GTGTCCACCCAGATTGAGGATGG - Intergenic
1159656877 18:71040433-71040455 GTGATTAAGCTTAGTGAGGAAGG + Intergenic
1160258368 18:77266551-77266573 GTCTCTTAGCAGTGTGAGAATGG - Intronic
1161705812 19:5820920-5820942 GTGTCTGAGCAGAGTGAGGAGGG - Intergenic
1162186337 19:8907726-8907748 GGGGCTGGGCAGAGTGAGGAGGG + Intronic
1165697945 19:37915291-37915313 GTGTCCAAGGAGAGGGAGCAGGG + Intronic
1166392255 19:42415365-42415387 GTGATTAAGCTTAGTGAGGAAGG + Intronic
1166580164 19:43890049-43890071 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1168135944 19:54352034-54352056 TTATCAAAGCAGAGTAAGGAGGG - Exonic
1168260246 19:55189482-55189504 CCGACTGAGCAGAGTGAGGAAGG - Intronic
925337974 2:3112442-3112464 GTGTCCATGCAGAGTGGGGCTGG - Intergenic
925363325 2:3294769-3294791 GTGTGTATGTAGAGAGAGGATGG - Intronic
925363524 2:3295754-3295776 GTGTGTGTGCAGAGAGAGGACGG - Intronic
925363568 2:3295960-3295982 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925363587 2:3296060-3296082 GTGTGTGTGCAGAGAGAGGAGGG - Intronic
925363655 2:3296375-3296397 GTGTGTGTGCAGAGAGAGGATGG - Intronic
925834862 2:7934721-7934743 CTGTCTAAGCAGTGTATGGAGGG + Intergenic
926317502 2:11721832-11721854 TTCTCTAAGCAGGGTGGGGAGGG + Intronic
926711928 2:15888842-15888864 GTGCCCAAGCAGAGTGGTGACGG + Intergenic
926781487 2:16476426-16476448 GTGTGTAAGCAGAGTGAGAAGGG - Intergenic
929444158 2:41989763-41989785 AGTTCTAAGCAGAGAGAGGAAGG + Intergenic
929831584 2:45351077-45351099 GAAGCTAAGAAGAGTGAGGAGGG - Intergenic
931996222 2:67841816-67841838 GTGTCTGTGGAGAGTGAGGGTGG - Intergenic
932937768 2:76126315-76126337 GTCTGTAATAAGAGTGAGGAAGG - Intergenic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933897346 2:86823932-86823954 GGGTCCAGGCAGAGAGAGGAGGG + Intronic
934605224 2:95689995-95690017 GCGCCTGAGCAGAGTGATGATGG - Intergenic
935331445 2:101980397-101980419 ATGTCTATGCAGAGCCAGGAAGG + Intergenic
935476981 2:103534745-103534767 GTGCCTACCCAGATTGAGGATGG - Intergenic
939350628 2:141033222-141033244 GTGGCTAGGCAGAGAGAGCAAGG + Intronic
939680428 2:145124284-145124306 GTGTCCAACCAGATTGAGGGTGG - Intergenic
941733036 2:168940173-168940195 ATGACTAAGCTCAGTGAGGAAGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
942246948 2:174016691-174016713 GTGACTAAGGAGACTGAGAAAGG - Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945878836 2:215305892-215305914 GTGTCTAAGGAATGTCAGGAAGG - Intergenic
947045269 2:225975368-225975390 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
947501920 2:230677161-230677183 CTATCTAAGCTGAGTCAGGAAGG - Intergenic
1171176348 20:23052845-23052867 GTGTCCAAGGAGATTGGGGAGGG + Intergenic
1171464385 20:25317497-25317519 GTGGCTAAGCAGAGTTCTGAAGG - Intronic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1172828005 20:37806797-37806819 CTGTCCAATCAGAGTTAGGAGGG + Intronic
1173381433 20:42546624-42546646 GTGATTAAGCTTAGTGAGGAAGG - Intronic
1173417310 20:42868458-42868480 GTATCTAAGCAAAGTGTTGAGGG + Intronic
1173762823 20:45579038-45579060 GAGCCTAAGCAGGGTGAAGAGGG - Intronic
1174237153 20:49103274-49103296 GTTCCTAAGCACAGTGGGGAGGG - Intergenic
1174674445 20:52340081-52340103 GGTTGTAAGCAAAGTGAGGATGG + Intergenic
1174850399 20:53988343-53988365 GAGACTAAGCAGAGAGAGAAAGG - Intronic
1175034290 20:55985122-55985144 GTGCCCAAGCAGGGTGAGGAAGG + Intergenic
1175649713 20:60708956-60708978 GTGACAAAGCTTAGTGAGGAAGG + Intergenic
1176024373 20:62978350-62978372 GTGTCTCAGCAGAGGGAGATGGG - Intergenic
1176886923 21:14267836-14267858 CTGTCTCAGCATAGAGAGGAAGG - Intergenic
1177807693 21:25890194-25890216 GTGGATGAGCAGTGTGAGGAAGG - Intronic
1178331449 21:31697630-31697652 GTCTATAAGCAGAATGAGCACGG - Intronic
1179404100 21:41111200-41111222 GGGTTTAAGCAGAGGGAGGCAGG + Intergenic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181462643 22:23094608-23094630 GTGCCTAAGCACAGTGGGCAGGG - Intronic
1181787508 22:25237702-25237724 GTCTCTAAGCAGCCTGCGGAGGG + Intergenic
1181853820 22:25768624-25768646 GGGTCAAAGCATAGTGGGGAAGG + Exonic
1183031344 22:35108656-35108678 GTGTCTCAGAAGGGTGAGTAAGG - Intergenic
1183922058 22:41177438-41177460 GTGGCTGAGCAGTCTGAGGAGGG - Exonic
1185178021 22:49341406-49341428 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950251445 3:11468932-11468954 GTGTGTGGGCAGATTGAGGATGG + Intronic
950644334 3:14368169-14368191 AGGCCTCAGCAGAGTGAGGAGGG - Intergenic
950678508 3:14569096-14569118 GCGTCTGGGCAGAGTGGGGAAGG - Intergenic
950744526 3:15076227-15076249 GTCACTAATCAAAGTGAGGAAGG + Intronic
950916954 3:16655841-16655863 GTGGCTGAGCAGAGTGAGTGAGG + Intronic
950988268 3:17400684-17400706 GTGCCCATCCAGAGTGAGGATGG - Intronic
951614744 3:24529896-24529918 CTGTAAAAGCAGGGTGAGGAGGG - Intergenic
954299428 3:49691529-49691551 CTGGCCCAGCAGAGTGAGGAGGG - Intronic
954944616 3:54409544-54409566 GTGATTAAGCTTAGTGAGGAAGG + Intronic
958794647 3:98693854-98693876 GTGTCTTAGCAGAGTGACATTGG + Intergenic
961486179 3:127218380-127218402 GAGTCTAGGCAAGGTGAGGATGG - Intergenic
963089621 3:141471085-141471107 TGGTCTCAGCAGATTGAGGAGGG - Intergenic
963942079 3:151105425-151105447 GTGTCTCAGCAGAAAGATGAGGG - Intronic
964599142 3:158475878-158475900 GTGACTAAGCTTAGTGAGGAAGG + Intronic
967582913 3:191180313-191180335 CTGTATTAGCAGTGTGAGGACGG + Intergenic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
968603309 4:1520540-1520562 GGGTCTTTGCAGAGTGACGACGG - Intergenic
968967040 4:3773963-3773985 GTGTCCTGGCACAGTGAGGACGG - Intergenic
969834625 4:9830570-9830592 GTGCCTAAGCAGAGTGAGACGGG - Intronic
969909832 4:10433672-10433694 GTTTCTAAGCACAGTTAGGGTGG + Intergenic
969999035 4:11345297-11345319 TCCTCTAAGCAGAGTGAGGCAGG - Intergenic
970139412 4:12965358-12965380 GGGTCAAAGCAGAGGGAGAAAGG + Intergenic
970254417 4:14152845-14152867 GTGTGAAATCAGAGTGAGGTGGG - Intergenic
970542798 4:17096131-17096153 TTGTCTAGGCTGTGTGAGGAAGG - Intergenic
970715642 4:18919265-18919287 GTGCATAAGCTGAGTTAGGATGG + Intergenic
972189332 4:36571015-36571037 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
972445136 4:39136563-39136585 GAGTCCAAGCAGGGTGAAGAGGG + Intergenic
973229328 4:47823912-47823934 GTGCCTAAGCAGGGTAAGGATGG - Intronic
973713278 4:53650344-53650366 GGGCCTAAGCAGGGTGCGGAGGG + Intronic
973901215 4:55474051-55474073 GTGATTAAGCTTAGTGAGGAAGG + Intronic
974011104 4:56608175-56608197 GTCTCTAAGCAAAGTGTTGAAGG + Intergenic
974293067 4:59959332-59959354 GTTACTCAGCAGACTGAGGAGGG + Intergenic
974598692 4:64047368-64047390 GTGTCTACCCAGATTGAGGGTGG - Intergenic
975211172 4:71701610-71701632 GTGTCAAAGGAGAGTGGGCAAGG - Intergenic
975655177 4:76634080-76634102 GTTTATTAGCAGAGTGAGAATGG - Intronic
978223110 4:106301390-106301412 GTTTAGAAGCAGAGTGAAGATGG - Intronic
978940900 4:114434954-114434976 CTGGCAAAGCAGAGTGAGGAAGG + Intergenic
980768114 4:137334976-137334998 ATGTTTAAGCTTAGTGAGGAAGG - Intergenic
981224896 4:142282729-142282751 GTGTCTTAGCAGACTGGAGATGG - Intronic
981342649 4:143639654-143639676 AGGTCTAAGCTGTGTGAGGAGGG + Intronic
981554361 4:145976903-145976925 GAGACTGAGCAGGGTGAGGAGGG + Intergenic
984373357 4:178894757-178894779 GTGGATAACCAGAGTGAGCAAGG + Intergenic
984583230 4:181534363-181534385 ATTTCTAAGCACAGTGATGAAGG + Intergenic
987621775 5:20344596-20344618 GTCTCTAGGCACAGTGAAGACGG - Intronic
988717607 5:33843393-33843415 GAGCCCAAGCAGGGTGAGGAGGG + Intronic
989088662 5:37704791-37704813 GTGTCTTTGGAGAGTGAGGCAGG + Intronic
989303750 5:39927132-39927154 GAGTCTAAGCAGGGTGAGGAGGG + Intergenic
989781145 5:45265973-45265995 ATATCTAAACAGAGAGAGGAAGG + Intronic
992672095 5:79070510-79070532 GTGACTAAGCAAAATTAGGAAGG + Intronic
994988135 5:106964214-106964236 GTGTGTAAGCAGAGGTAGCAGGG + Intergenic
995047153 5:107664747-107664769 TTCCCTAAGCACAGTGAGGAAGG - Intronic
995576678 5:113543740-113543762 GTGTCTAGGCACAGTGAACAAGG - Intronic
995694623 5:114865654-114865676 GTGTGAAAGCTGGGTGAGGATGG - Intergenic
996491796 5:124106600-124106622 GTATCTAAGCTCAGTGATGAAGG + Intergenic
997718161 5:136057452-136057474 GTGGCTAAGAAAAATGAGGAAGG + Intronic
998230966 5:140361174-140361196 GTGTCTGGGCAGAGGGAGAAGGG + Intronic
998579290 5:143354377-143354399 GTGGCTAAACTTAGTGAGGAAGG - Intronic
998672659 5:144371174-144371196 TTGTTGAAGCAGAGTGAGGCAGG - Intronic
999095448 5:148973954-148973976 GGGACCAAGCAGAGTGAAGATGG - Intronic
1002061323 5:176627635-176627657 GTGTCTAGGCAGACTGAGCCCGG + Intronic
1002667708 5:180838208-180838230 GAGCCCAAGCAGGGTGAGGAGGG + Intergenic
1004027520 6:11833603-11833625 GTGAAGAATCAGAGTGAGGAAGG + Intergenic
1004721220 6:18268926-18268948 GAGTCTGAGCTGAGTAAGGAGGG + Intergenic
1005915888 6:30351214-30351236 GTTTCAAAGCAGAGTGAGGCAGG - Intergenic
1005959204 6:30684255-30684277 GTGTATGTGCAGAGCGAGGAAGG + Intronic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1007618356 6:43196035-43196057 ATGTGAAAGCAGAGTGAGGAGGG - Intronic
1008975152 6:57417404-57417426 GTGACTAAGCTTAGTGAGAAAGG - Intronic
1009164036 6:60318923-60318945 GTGACTAAGCTTAGTGAGAAAGG - Intergenic
1010804395 6:80217864-80217886 GTTTTTAACCAGAGTCAGGAAGG + Intronic
1011423829 6:87203925-87203947 AAGCCTAAGCAGAGTGAGGAGGG + Intronic
1012012504 6:93807074-93807096 GAATCTAAGCAGGGTGAGGAGGG - Intergenic
1012836712 6:104278780-104278802 ATGACTAAGCTTAGTGAGGAAGG - Intergenic
1013381898 6:109581288-109581310 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1014814631 6:125921924-125921946 GTCTCTAAGCTGACTGATGAGGG - Intronic
1015555755 6:134459752-134459774 TTCTTTAATCAGAGTGAGGAGGG - Intergenic
1017973675 6:159335772-159335794 GGGTCCAAACAGAGTGAAGAAGG + Intergenic
1020019091 7:4851659-4851681 GTTTCCAAGCAGAGTGTAGAAGG + Intronic
1020939397 7:14511701-14511723 ATGATTAAGCTGAGTGAGGAAGG - Intronic
1022296062 7:29054729-29054751 ATGTCTAAGCAGAGTCAGAGAGG - Intronic
1022808125 7:33843460-33843482 GTGTGTGAGCTGAGTGAGGCTGG + Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023496944 7:40807964-40807986 GTGTCTACCCAGATTGAGGGTGG + Intronic
1023537811 7:41231928-41231950 GTGTGGGAGCAGAGTGAGGCCGG - Intergenic
1023878776 7:44307062-44307084 GGGTCTGAGCAGGGGGAGGAGGG + Intronic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1024353814 7:48394419-48394441 GTGTCTGAGAAGAGCCAGGACGG - Intronic
1024706079 7:51961336-51961358 GTGTCTAAGCAGTGCAGGGAAGG - Intergenic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027362232 7:77421422-77421444 GAGTCTAAGTAGGGTGAGAAGGG + Intergenic
1027814092 7:82946657-82946679 TGGTCGGAGCAGAGTGAGGAGGG + Intronic
1028082752 7:86599025-86599047 GTGTCTGAGCTGACTGAGCACGG + Intergenic
1028423780 7:90663391-90663413 GAGTCTTAGCACAGTGAGCAGGG + Intronic
1030172912 7:106622663-106622685 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1030844586 7:114393408-114393430 GAGCCCAAGCAGAGTAAGGAAGG + Intronic
1030844591 7:114393467-114393489 GAGTCTGACCAGAGAGAGGAGGG + Intronic
1031744936 7:125483636-125483658 GTGTGTAAGAAGACAGAGGAGGG + Intergenic
1031794484 7:126154297-126154319 GTGTCAAAGAGGAGTGAGGTGGG - Intergenic
1032010050 7:128339974-128339996 GTTTCTAAGCAAAGTGGGGAGGG - Intronic
1032180868 7:129676344-129676366 ATGACTAAGCTTAGTGAGGAAGG - Intronic
1032235501 7:130118640-130118662 TTGACTAAGCTTAGTGAGGAAGG - Intronic
1033274208 7:139958906-139958928 GTTTCTCCGCAGAGTGAGGCTGG + Intronic
1033712599 7:143963860-143963882 GTGCCTACCCAGATTGAGGATGG + Intergenic
1033792620 7:144809533-144809555 GTGTATGAGCAGAGAGATGATGG - Intronic
1034441815 7:151089489-151089511 AAGTCTAAACAGAGTGAGGGAGG - Intronic
1034841860 7:154405507-154405529 TTTTCTAAGCAGACTGAGAAAGG + Intronic
1034889501 7:154827613-154827635 AAGCCCAAGCAGAGTGAGGAGGG + Intronic
1034889519 7:154827677-154827699 CAGCCCAAGCAGAGTGAGGAGGG + Intronic
1035340448 7:158157405-158157427 GTGTTTAAGCAGAGTCTGTAAGG + Intronic
1035425532 7:158769627-158769649 GTCTCTAAGCTGAGTGTTGAAGG - Intronic
1035749610 8:1987167-1987189 GTGTAAAAACAGAGAGAGGAAGG - Intronic
1038363041 8:26902006-26902028 GTGGCTGAGGAGAGTGAGCAAGG + Intergenic
1038424623 8:27456652-27456674 ATGATTAAGCTGAGTGAGGAAGG + Intronic
1039826705 8:41180476-41180498 GTGTTTGGGCAGAGTGAGGATGG - Intergenic
1040485209 8:47864637-47864659 GTGCCACAGCAGAGTGAGGAGGG + Exonic
1040993413 8:53376263-53376285 CAGTCTAAGGAGAGTCAGGAGGG + Intergenic
1042662976 8:71176194-71176216 GTGTCTCATCATAGAGAGGAAGG + Intergenic
1045569304 8:103353041-103353063 GTGTCTGATCAGTCTGAGGATGG - Intergenic
1046438321 8:114225268-114225290 GTGTCTAACCAGAGTGAAAGAGG - Intergenic
1047647686 8:126886163-126886185 GTGTTTAAGAAGAGGGAAGAAGG - Intergenic
1048384650 8:133900901-133900923 GAGCCTAAGCAGAGTGAGGAGGG - Intergenic
1048726312 8:137388924-137388946 TCGTCTGAGCAGAGTGAGCAAGG - Intergenic
1049062579 8:140287363-140287385 GAGACGAAGCAGAGGGAGGAGGG + Intronic
1049386920 8:142347480-142347502 GTCTCTGTGCAGAGAGAGGATGG - Intronic
1050580017 9:7044314-7044336 GTGTCTAAACACAGTGAGGCTGG + Intronic
1052238733 9:26246813-26246835 GTTTCTAAGCAGTGTTATGAAGG + Intergenic
1053486143 9:38457870-38457892 CTGTTTCAGCAGAGTGATGAGGG + Intergenic
1053620637 9:39810637-39810659 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053626072 9:39873298-39873320 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1053878803 9:42569923-42569945 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1053893869 9:42724448-42724470 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054217816 9:62377403-62377425 ATGATTAAGCTGAGTGAGGAAGG - Intergenic
1054232886 9:62531772-62531794 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1054263526 9:62896807-62896829 ATGATTAAGCTGAGTGAGGAAGG + Intergenic
1055753296 9:79530552-79530574 GTGTCTGAGCCCAGTGTGGATGG + Intergenic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056336102 9:85570837-85570859 GAGCCTAAGCAGGGTGAGGAAGG + Intronic
1057134670 9:92679508-92679530 GTGTCAGAGAAGCGTGAGGAGGG + Intergenic
1060386092 9:123230089-123230111 GAATTTAAGCTGAGTGAGGAAGG + Intronic
1060445208 9:123681091-123681113 GCGTCTGAGCAGGATGAGGAGGG + Intronic
1060843963 9:126819723-126819745 ATGACTAAGCTTAGTGAGGAAGG + Intronic
1060856498 9:126917838-126917860 GTTTCTTAGCTGAGTGAGGAGGG + Intronic
1060942154 9:127548984-127549006 GTGTGTAAGCAGAGGCTGGAGGG + Intronic
1061512933 9:131071811-131071833 GACTCTAAGCTCAGTGAGGATGG + Intronic
1186646918 X:11517105-11517127 GTGTCTAGGTAGACTGAGGCTGG + Intronic
1187824772 X:23323954-23323976 ATTTCTTATCAGAGTGAGGAAGG - Intergenic
1189648853 X:43166042-43166064 GTGTCTCAGCAGCCTGAGAAAGG + Intergenic
1190189494 X:48265315-48265337 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190658254 X:52631816-52631838 ATGGCTAAGCTTAGTGAGGAGGG - Intergenic
1190660187 X:52646834-52646856 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1190663396 X:52675978-52676000 ATGGCTAAGCTTAGTGAGGAAGG - Intronic
1190676027 X:52782504-52782526 ATGGCTAAGCTTAGTGAGGAAGG + Intronic
1191849018 X:65571896-65571918 GATTCTGAGCAGAGGGAGGAAGG + Intergenic
1194531248 X:95051882-95051904 GTGTCCAACCAGATTGAGGGCGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195013041 X:100752098-100752120 GAGCCCAAGCAGAGTGAGGAAGG + Intergenic
1195013155 X:100752797-100752819 TTATCCAAGCAGAGTGAGAAGGG + Intergenic
1195271261 X:103233374-103233396 TTGCCTGAGCAGGGTGAGGAAGG + Intergenic
1198327472 X:135587558-135587580 GTTTCTTAGCTGAGAGAGGAGGG - Intergenic
1199361864 X:146929637-146929659 ATGTCTAAGCAAAGTGCTGAAGG + Intergenic
1199905392 X:152223549-152223571 GTGGCTGGCCAGAGTGAGGAAGG - Intronic
1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG + Intergenic
1202381384 Y:24278465-24278487 GAGCCTAAGCAGGGTGAGGTGGG + Intergenic
1202489401 Y:25391661-25391683 GAGCCTAAGCAGGGTGAGGTGGG - Intergenic