ID: 1098840877

View in Genome Browser
Species Human (GRCh38)
Location 12:75476391-75476413
Sequence ATGCATACCTAGAGTAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098840876_1098840877 -1 Left 1098840876 12:75476369-75476391 CCTATCAGTATGGAATGCACTTA 0: 1
1: 0
2: 0
3: 7
4: 255
Right 1098840877 12:75476391-75476413 ATGCATACCTAGAGTAATAAAGG 0: 1
1: 0
2: 1
3: 10
4: 127
1098840874_1098840877 5 Left 1098840874 12:75476363-75476385 CCAAACCCTATCAGTATGGAATG 0: 1
1: 0
2: 5
3: 42
4: 338
Right 1098840877 12:75476391-75476413 ATGCATACCTAGAGTAATAAAGG 0: 1
1: 0
2: 1
3: 10
4: 127
1098840875_1098840877 0 Left 1098840875 12:75476368-75476390 CCCTATCAGTATGGAATGCACTT 0: 1
1: 0
2: 0
3: 24
4: 179
Right 1098840877 12:75476391-75476413 ATGCATACCTAGAGTAATAAAGG 0: 1
1: 0
2: 1
3: 10
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098840877 Original CRISPR ATGCATACCTAGAGTAATAA AGG Intergenic
900006730 1:61485-61507 AAAAATACCAAGAGTAATAATGG - Intergenic
901267957 1:7926683-7926705 ATGTATAACTACAGTAATCAAGG + Intronic
903789742 1:25884729-25884751 ATGGAGACCCAGAGAAATAAAGG + Intronic
904346457 1:29874811-29874833 CTGTATACCTAGGGTAATCAAGG + Intergenic
909841244 1:80327400-80327422 AAGCAAACCTGGAGTAATTAGGG - Intergenic
919954936 1:202404320-202404342 ATGCATGCATAGACTAAAAAGGG - Intronic
921326809 1:213993393-213993415 ATACATATCTTGAGAAATAAAGG + Intronic
923003465 1:230026614-230026636 ATGCACACCAAGAGGAAAAATGG + Intergenic
923200336 1:231704873-231704895 AGCCACACTTAGAGTAATAATGG + Intronic
1064605418 10:17033972-17033994 ATGCATTCCAAGAGGAAGAATGG - Intronic
1066312845 10:34214323-34214345 ATGTATAGCCAGACTAATAATGG - Intronic
1071313613 10:84368869-84368891 AGGCATACAGAGAGGAATAATGG - Intronic
1072045875 10:91654306-91654328 CTGCATACCTAATGTAATACAGG - Intergenic
1074171144 10:110938403-110938425 ATCAATAACTAGAGTAACAAAGG - Intronic
1075232868 10:120698797-120698819 AAGCATATTTAGAGAAATAATGG - Intergenic
1079661319 11:23040416-23040438 ATGCATAAATATAGTATTAAAGG - Intergenic
1079819798 11:25111309-25111331 ATTCATAGCTAGAGCAATCAGGG - Intergenic
1080547656 11:33336850-33336872 AGGCATACCTAAAGTAATTGTGG - Intronic
1083590148 11:63888976-63888998 AGGCAATCCTAGAGTAAAAAGGG - Intronic
1084003222 11:66309830-66309852 AGGCAAACATAGAGCAATAAAGG + Intergenic
1085713105 11:78848040-78848062 AGGCATACCTAGAGAAAAAGAGG + Intronic
1087449100 11:98295177-98295199 ATGCATAACTATAGTCAGAAAGG - Intergenic
1088202490 11:107354301-107354323 ATACATACATAAAGTCATAATGG + Intronic
1089897217 11:121942808-121942830 TTGCCTACATAGAATAATAATGG + Intergenic
1094788767 12:33884115-33884137 ATATATACCTAAAGAAATAATGG + Intergenic
1095661299 12:44740285-44740307 AAGTACACCCAGAGTAATAAAGG - Intronic
1097623345 12:61968358-61968380 ATTCATATGTAGAGTACTAATGG - Intronic
1098840877 12:75476391-75476413 ATGCATACCTAGAGTAATAAAGG + Intergenic
1107200016 13:37703818-37703840 ATAAATGCCTAGAGTAAGAATGG - Intronic
1107742170 13:43462372-43462394 TTGCATACCCAGACTATTAATGG - Intronic
1111442327 13:88296005-88296027 ATGCATTCATGGAGAAATAAGGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1117430694 14:55656796-55656818 ATGGATACCTAGATTATTTAGGG + Intronic
1120599508 14:86484423-86484445 ATACATACCTAGATTAATAGAGG - Intergenic
1121187115 14:91983426-91983448 ATCCATACATAAAGAAATAAGGG + Intronic
1122164774 14:99814159-99814181 ATGGAAACCTAGAGTTGTAAAGG + Intronic
1127319345 15:57827228-57827250 ACTCATACCTAGAGCAAAAAGGG + Intergenic
1131731335 15:95284697-95284719 ATGCATTCTTAAAGTGATAATGG + Intergenic
1134385553 16:13768859-13768881 ATGCATACAGAGGGTAATGAAGG - Intergenic
1137712734 16:50577775-50577797 ATGCCTACCTTGATTAAGAATGG - Intronic
1138188044 16:54991782-54991804 AGACATACCTGAAGTAATAACGG + Intergenic
1138921220 16:61531494-61531516 ATGAAAAGCAAGAGTAATAAAGG - Intergenic
1141738649 16:85873787-85873809 TTGCATTCCTAGTGGAATAAAGG + Intergenic
1151270163 17:72987911-72987933 ATTCATGCCAAGAGTAATAATGG - Intronic
1153176721 18:2382864-2382886 ATGTATACCTAGGGGAAAAAAGG + Intergenic
1157281624 18:46350092-46350114 ATACATACCCAGAGAAATACAGG + Intronic
1157406511 18:47426431-47426453 ATGCTGACCTAGAGTAAAACTGG - Intergenic
1168554926 19:57329969-57329991 ATGCATACACAGAAAAATAAAGG - Exonic
934055710 2:88249926-88249948 ATGCTTTCCTAGAAAAATAAAGG + Intergenic
936656187 2:114490312-114490334 ATGCCTACACAGAGTTATAAAGG - Intronic
936988722 2:118339383-118339405 AAGCATATTTAGAGAAATAATGG - Intergenic
937190735 2:120095375-120095397 AAGAATATCTAGAGAAATAATGG - Intronic
937752621 2:125495465-125495487 AAACATACCTAGAGAAACAATGG - Intergenic
937838563 2:126499019-126499041 ATCCATACCTAGAAAAATTATGG + Intergenic
940255610 2:151725047-151725069 ATGCAGACCTAGAGTCATTGGGG - Intronic
942536055 2:176965527-176965549 ATGCATACATAAAATAATAATGG - Intergenic
943882305 2:193161267-193161289 ATGCCCACCTAAAGAAATAATGG - Intergenic
944847680 2:203684976-203684998 ATGCTTACATAGAGAAAGAAAGG + Intergenic
946134033 2:217630956-217630978 ATGCATACTTAGATTAATAATGG - Intronic
1169247707 20:4036840-4036862 AGGCAAACCTATAGTAATAATGG + Intergenic
1177810208 21:25917301-25917323 AGGCATACTTAGAGTAACAGAGG + Intronic
1177890948 21:26803408-26803430 ATGTGTACCCAGATTAATAAAGG - Intergenic
1179388740 21:40968040-40968062 TTGCATACCTAGAGAGACAAAGG - Intergenic
1182168862 22:28206117-28206139 ATGCATAATTAGAATAATCATGG - Intronic
1185200410 22:49499422-49499444 ATGGACTCCTAGAGTAAGAAAGG + Intronic
952985457 3:38776413-38776435 ATGCAAAGCGACAGTAATAATGG + Intronic
953275863 3:41496782-41496804 TTGAATACCTAGAGTAGTTAGGG - Intronic
957407717 3:79792854-79792876 AAGCATAACTAGGGTAAAAAAGG + Intergenic
958926737 3:100166496-100166518 CTGGATTCCTAGAGCAATAATGG - Intronic
965418614 3:168428230-168428252 ATTTAGACCTAGAGGAATAAGGG - Intergenic
965620594 3:170639039-170639061 ATGTCTGCCTAGAGAAATAAGGG + Intronic
965899686 3:173623311-173623333 GTGCATACATAGTGTAAAAATGG + Intronic
967041871 3:185701426-185701448 AAGAATACCTAGTGTAATTATGG - Intronic
969172073 4:5372138-5372160 ATGCATACCTGCAGTCAGAAGGG + Intronic
969362864 4:6676156-6676178 AGGCAGACCTAGAGTAGGAAAGG + Intergenic
970513934 4:16808643-16808665 ATGGATGCCTAGAGAAATAAAGG + Intronic
971614943 4:28776798-28776820 ATGCATCCCTATAGCAATATTGG + Intergenic
972411782 4:38802360-38802382 ATGCATACCAAGAGGCAAAATGG + Intronic
972464211 4:39337632-39337654 AGGGAAACCTAGAGTGATAAAGG - Intronic
973866518 4:55119645-55119667 GTGCATATCTGGAGTATTAAGGG + Intronic
976513189 4:85934003-85934025 TTGCATACATGGAGCAATAAAGG - Intronic
981854186 4:149267917-149267939 ATGCATACATAAATGAATAAGGG + Intergenic
982345621 4:154354541-154354563 ATCCATACATAAAGTAATGAGGG - Intronic
982403547 4:154995575-154995597 GAGCATACCTAGAGTATCAAAGG - Intergenic
986171302 5:5316985-5317007 ATCCATACCTAGATTAATTTTGG + Intronic
990330282 5:54719146-54719168 ATACATACATAGAATTATAAAGG - Intergenic
990542992 5:56793269-56793291 ATGAATACATAGAGAAACAAGGG - Intergenic
991491767 5:67190767-67190789 ATGAATACCTAGAGGGAAAAGGG - Intronic
996118576 5:119646179-119646201 AGGCATACTTAGACTAAAAATGG - Intergenic
996284632 5:121774496-121774518 ATGCATCCCTAGATAGATAAGGG + Intergenic
996425483 5:123308949-123308971 TTGCATACCTAGTGTAATTTTGG + Intergenic
998343304 5:141438109-141438131 ATGCATTCCTAAAATATTAATGG + Intronic
999428797 5:151508738-151508760 CAGCATACCCAGAGTAATCATGG + Intronic
1001205635 5:169760136-169760158 AAGCATACCTAAAGAGATAATGG + Intronic
1001623072 5:173105440-173105462 TTGCTTACCTAGTGTAACAAGGG + Intronic
1002141399 5:177142452-177142474 AGGCATGCCTAGAATAATCAGGG + Intronic
1005250163 6:23936419-23936441 ATGCATAGCTAGAGGCAAAATGG - Intergenic
1006312222 6:33268863-33268885 ATGCATACCTAAAGAAATGGTGG + Intronic
1007651769 6:43427072-43427094 ATGCAGCCCTAGAATAATAAGGG + Intergenic
1008710737 6:54223960-54223982 ATGAATAAGAAGAGTAATAAAGG + Intronic
1009487039 6:64237370-64237392 ATGCATAATTAGAGAAATAGGGG - Intronic
1009746313 6:67821158-67821180 ATACATACTTGAAGTAATAATGG - Intergenic
1011546633 6:88488468-88488490 ATGTATACCTAGAGTCCTGAAGG - Intergenic
1012002364 6:93668652-93668674 CTGCATACCAAAAGTAGTAATGG - Intergenic
1012276180 6:97278107-97278129 ATGTATAGCTAAGGTAATAAAGG - Intronic
1012481780 6:99675678-99675700 ATGGATACCTAGAATAACCAGGG - Intergenic
1012664815 6:101954817-101954839 ATCCACACCTAATGTAATAATGG - Intronic
1014711479 6:124811111-124811133 ATTCATACCTATGGAAATAATGG + Intronic
1014977131 6:127901255-127901277 ATGCACACCTGGATTAACAAAGG - Intronic
1015126341 6:129759128-129759150 AAGCACACACAGAGTAATAAGGG + Intergenic
1016393250 6:143596240-143596262 ATGAAGACCTAGAGGAATAAAGG - Intronic
1016664479 6:146620342-146620364 AAGCATATCTAAAGAAATAATGG - Intronic
1020501436 7:8926706-8926728 ATGCATTCCTTTAGTAAAAAAGG - Intergenic
1021811594 7:24407055-24407077 CTGCATTCCTAGAGGAATGAAGG + Intergenic
1024546546 7:50526854-50526876 ATGCATTACTAGAGATATAAAGG + Intronic
1024823389 7:53360766-53360788 AAGCATACCTAGAGTGAAAGTGG + Intergenic
1031928328 7:127659621-127659643 ATGTATATCAAGAGGAATAAAGG + Intronic
1033426742 7:141251671-141251693 AAGTATACCTGGGGTAATAAAGG - Intronic
1034219087 7:149430788-149430810 ATGAATACCTAGAGAAACCAGGG + Intergenic
1038505978 8:28085429-28085451 ATACATACCTAGAGTACTGAGGG - Intergenic
1039182995 8:34887394-34887416 ATCAAGAACTAGAGTAATAAAGG + Intergenic
1039786245 8:40836982-40837004 ATACATACATAGACAAATAATGG + Intronic
1040533754 8:48288044-48288066 ATGAAGACCTAGAGTCAGAAGGG + Intergenic
1040714289 8:50228816-50228838 ATGCATACCTGTAGAAAGAAAGG + Intronic
1041908532 8:63061548-63061570 ATTCATAACCAGAGGAATAAAGG - Intronic
1043245160 8:77990182-77990204 ATGAAAACCTAAAGTAATAGCGG + Intergenic
1044153219 8:88808892-88808914 ATGAATGCATAGAGAAATAATGG + Intergenic
1044301028 8:90583113-90583135 CTGGATGCCTAGAGTAAAAAGGG + Intergenic
1046460494 8:114527739-114527761 AAGCATACCAAGTGTAAAAATGG - Intergenic
1047022635 8:120792307-120792329 ATGCATACAGAGAGGGATAATGG + Intronic
1047845682 8:128802478-128802500 ATGGATAACTAGAATAATCAAGG + Intergenic
1056199593 9:84262075-84262097 ATGCATAACAATAGTAATAATGG - Intergenic
1059665949 9:116446804-116446826 TTGCATACCTACAGTAATACAGG + Intronic
1191598812 X:62979164-62979186 ATCAATAACAAGAGTAATAATGG - Intergenic
1194054233 X:89110850-89110872 ATGCATTCCTGTAGTAATACAGG + Intergenic
1195142983 X:101982268-101982290 CTACAAACCTACAGTAATAAAGG + Intergenic
1195871943 X:109495394-109495416 ATGTATACCTAGAGAAGGAAAGG + Intergenic
1198007623 X:132514116-132514138 ATGGATAGCTACAGTAATCAAGG + Intergenic
1200853918 Y:7916931-7916953 AAGCAAACCTACAGTAACAAAGG + Intergenic