ID: 1098841395

View in Genome Browser
Species Human (GRCh38)
Location 12:75482536-75482558
Sequence CCTAGTGCATGGCACACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2310
Summary {0: 1, 1: 4, 2: 51, 3: 408, 4: 1846}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098841395_1098841402 5 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841402 12:75482564-75482586 CGCACGGTGCTACACAAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1098841395_1098841403 24 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841403 12:75482583-75482605 AGGGAGAAAAAGTCAGTCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 472
1098841395_1098841401 4 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841401 12:75482563-75482585 ACGCACGGTGCTACACAAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 36
1098841395_1098841399 1 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841399 12:75482560-75482582 ACCACGCACGGTGCTACACAAGG 0: 1
1: 0
2: 1
3: 4
4: 52

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098841395 Original CRISPR CCTAGTGCATGGCACACAGT AGG (reversed) Intronic