ID: 1098841397

View in Genome Browser
Species Human (GRCh38)
Location 12:75482547-75482569
Sequence CGTGCGTGGTGCCTAGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 67}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098841397_1098841403 13 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841403 12:75482583-75482605 AGGGAGAAAAAGTCAGTCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 472
1098841397_1098841399 -10 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841399 12:75482560-75482582 ACCACGCACGGTGCTACACAAGG 0: 1
1: 0
2: 1
3: 4
4: 52
1098841397_1098841404 25 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841404 12:75482595-75482617 TCAGTCCCAGGCCAACAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 184
1098841397_1098841402 -6 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841402 12:75482564-75482586 CGCACGGTGCTACACAAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1098841397_1098841401 -7 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841401 12:75482563-75482585 ACGCACGGTGCTACACAAGGAGG 0: 1
1: 0
2: 0
3: 1
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098841397 Original CRISPR CGTGCGTGGTGCCTAGTGCA TGG (reversed) Intronic