ID: 1098841401 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:75482563-75482585 |
| Sequence | ACGCACGGTGCTACACAAGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 38 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 1, 4: 36} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098841397_1098841401 | -7 | Left | 1098841397 | 12:75482547-75482569 | CCATGCACTAGGCACCACGCACG | 0: 1 1: 0 2: 0 3: 4 4: 67 |
||
| Right | 1098841401 | 12:75482563-75482585 | ACGCACGGTGCTACACAAGGAGG | 0: 1 1: 0 2: 0 3: 1 4: 36 |
||||
| 1098841395_1098841401 | 4 | Left | 1098841395 | 12:75482536-75482558 | CCTACTGTGTGCCATGCACTAGG | 0: 1 1: 4 2: 51 3: 408 4: 1846 |
||
| Right | 1098841401 | 12:75482563-75482585 | ACGCACGGTGCTACACAAGGAGG | 0: 1 1: 0 2: 0 3: 1 4: 36 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098841401 | Original CRISPR | ACGCACGGTGCTACACAAGG AGG | Intronic | ||