ID: 1098841402

View in Genome Browser
Species Human (GRCh38)
Location 12:75482564-75482586
Sequence CGCACGGTGCTACACAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098841395_1098841402 5 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841402 12:75482564-75482586 CGCACGGTGCTACACAAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28
1098841397_1098841402 -6 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841402 12:75482564-75482586 CGCACGGTGCTACACAAGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098841402 Original CRISPR CGCACGGTGCTACACAAGGA GGG Intronic