ID: 1098841403

View in Genome Browser
Species Human (GRCh38)
Location 12:75482583-75482605
Sequence AGGGAGAAAAAGTCAGTCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 6, 3: 45, 4: 472}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098841400_1098841403 -1 Left 1098841400 12:75482561-75482583 CCACGCACGGTGCTACACAAGGA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1098841403 12:75482583-75482605 AGGGAGAAAAAGTCAGTCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 472
1098841395_1098841403 24 Left 1098841395 12:75482536-75482558 CCTACTGTGTGCCATGCACTAGG 0: 1
1: 4
2: 51
3: 408
4: 1846
Right 1098841403 12:75482583-75482605 AGGGAGAAAAAGTCAGTCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 472
1098841397_1098841403 13 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841403 12:75482583-75482605 AGGGAGAAAAAGTCAGTCCCAGG 0: 1
1: 0
2: 6
3: 45
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098841403 Original CRISPR AGGGAGAAAAAGTCAGTCCC AGG Intronic