ID: 1098841404

View in Genome Browser
Species Human (GRCh38)
Location 12:75482595-75482617
Sequence TCAGTCCCAGGCCAACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098841397_1098841404 25 Left 1098841397 12:75482547-75482569 CCATGCACTAGGCACCACGCACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 1098841404 12:75482595-75482617 TCAGTCCCAGGCCAACAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 184
1098841400_1098841404 11 Left 1098841400 12:75482561-75482583 CCACGCACGGTGCTACACAAGGA 0: 1
1: 0
2: 0
3: 2
4: 46
Right 1098841404 12:75482595-75482617 TCAGTCCCAGGCCAACAGAGAGG 0: 1
1: 0
2: 1
3: 18
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098841404 Original CRISPR TCAGTCCCAGGCCAACAGAG AGG Intronic