ID: 1098842683

View in Genome Browser
Species Human (GRCh38)
Location 12:75495333-75495355
Sequence CAGAGCTGTCACAATTAAAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098842683 Original CRISPR CAGAGCTGTCACAATTAAAT GGG Exonic
903271272 1:22189953-22189975 CAGAGCTGTTGCAATTTAAGAGG + Intergenic
910395058 1:86784396-86784418 CAGACCTGTCACTATTAATAAGG + Intergenic
911354587 1:96800422-96800444 CAGATCTGTCACACTAAAAAGGG + Intronic
911989169 1:104670463-104670485 CAGAGATGTCATAATTTTATAGG + Intergenic
913362568 1:117998701-117998723 CAGAGATGACACAACCAAATGGG - Intronic
913973586 1:143435945-143435967 CAGTGCTGTAACGATTAGATGGG - Intergenic
914067974 1:144261552-144261574 CAGTGCTGTAACGATTAGATGGG - Intergenic
914111181 1:144704802-144704824 CAGTGCTGTAACGATTAGATGGG + Intergenic
917561512 1:176162059-176162081 CAGAGCTGTCCCAATCAAACAGG + Intronic
917703542 1:177606179-177606201 CATAGTCATCACAATTAAATTGG + Intergenic
918670212 1:187205366-187205388 TAGAGCTATCACAGTGAAATAGG + Intergenic
919507959 1:198423975-198423997 CAGAGCTTTTACAATTTAATTGG - Intergenic
921404148 1:214760586-214760608 CAGAGATGACATAAATAAATGGG - Intergenic
922004834 1:221519706-221519728 CAGAGCTATCACAAGTGATTTGG - Intergenic
1063795577 10:9510939-9510961 CAGAGCTGTGACAATAGAAAAGG - Intergenic
1066650389 10:37649665-37649687 CAAATCTTTCAAAATTAAATGGG + Intergenic
1067033338 10:42895502-42895524 CAAAGCTTTCAAAATTAAATGGG + Intergenic
1067245763 10:44541493-44541515 CAGAGATGACACAAATAAATGGG - Intergenic
1068890422 10:62142903-62142925 CAGAGATGACACAAACAAATGGG + Intergenic
1069340959 10:67407911-67407933 CAGAGATGACACAAACAAATGGG + Intronic
1070428297 10:76310615-76310637 CACAGCTGTCACAATAATTTGGG + Intronic
1075018387 10:118928166-118928188 AAGAATTGTCACAATCAAATAGG + Intergenic
1078761736 11:14257229-14257251 TACAGTTGTCAGAATTAAATGGG + Intronic
1079981275 11:27153906-27153928 CAAAACTGTCACAATTGAAGAGG + Intergenic
1080035615 11:27707010-27707032 TAGACCTTTCACATTTAAATTGG + Intronic
1085930846 11:81081576-81081598 CAGAGATGACAGAAATAAATGGG - Intergenic
1085932193 11:81097168-81097190 CATAGCTATCACATTTAAACAGG + Intergenic
1085947508 11:81289596-81289618 CAGAGCTGTAAGAATAAAAAAGG - Intergenic
1086816412 11:91377721-91377743 CAAAACTTTCACAATAAAATGGG + Intergenic
1087012777 11:93529451-93529473 CAGAGGGGTCACAATGACATCGG + Intronic
1088229264 11:107657162-107657184 CAAAGCTGTCACAATGAATTGGG + Intronic
1088339130 11:108743171-108743193 CAGATCTGCCACAATCAAGTAGG + Intronic
1088945506 11:114508239-114508261 CAGAGCTGACACAAACAAATGGG + Intergenic
1089104665 11:115992404-115992426 CATAGCTGTCATCATTGAATGGG - Intergenic
1089578409 11:119463396-119463418 AAGAGCTCAAACAATTAAATAGG - Intergenic
1090895290 11:130966885-130966907 CAGAGATGACACAAGCAAATGGG - Intergenic
1091486724 12:896492-896514 CAGAGCCTTCACATCTAAATGGG + Exonic
1093060272 12:14595055-14595077 CAGAGATGACACAAACAAATGGG - Intergenic
1093385333 12:18546699-18546721 AAGAGCTGACATAAATAAATTGG + Intronic
1093510686 12:19923708-19923730 AAGAGCTGTAACACTTATATAGG + Intergenic
1095450348 12:42324552-42324574 CACATCTGGCATAATTAAATCGG - Intronic
1097512449 12:60560666-60560688 CAGAGATGACACAAACAAATGGG - Intergenic
1098347449 12:69521048-69521070 CAGAGATGACACAAACAAATGGG - Intronic
1098842683 12:75495333-75495355 CAGAGCTGTCACAATTAAATGGG + Exonic
1099058972 12:77881920-77881942 CAGAGATGACACAAATAATTGGG + Intronic
1099569408 12:84296841-84296863 CAGAGATGACACAAACAAATGGG - Intergenic
1099768771 12:87025201-87025223 CACAGATGACACAAATAAATGGG + Intergenic
1101271480 12:103150280-103150302 CAGGAATCTCACAATTAAATAGG + Intergenic
1101271754 12:103154294-103154316 CAGACTTATCACAATTACATAGG - Intronic
1101743632 12:107521451-107521473 GAAAGCTGTCAGAATTAAAATGG - Intronic
1101850390 12:108397323-108397345 CAGAGCTGTGACATTTAAATGGG + Intergenic
1103169727 12:118806213-118806235 CAGAGATGACACAAACAAATGGG - Intergenic
1105802434 13:23919479-23919501 CAGAGATGACACAAATAAATGGG + Intergenic
1106164315 13:27229339-27229361 CAAAGATGTCAAAATTCAATCGG - Intergenic
1106913353 13:34486554-34486576 GACAGCTGTCAGAATGAAATAGG + Intergenic
1109606657 13:64705988-64706010 CAGATCTGTCACTATTAGAGGGG - Intergenic
1109621500 13:64913155-64913177 CAGAGATGACACAAACAAATGGG + Intergenic
1109790345 13:67239535-67239557 CAGAGATTTCACCCTTAAATAGG - Intergenic
1112752892 13:102599618-102599640 CAGACCTGTCACAAAAGAATTGG - Intronic
1115897446 14:38105696-38105718 CAGATCTGTCACCATCAAAGGGG + Intergenic
1116741089 14:48755625-48755647 CACAGGTGTCACAATTTAATAGG - Intergenic
1117184998 14:53231236-53231258 CAGAGCACTCACAAGGAAATTGG + Intergenic
1119760759 14:77149490-77149512 CAGAAGTGACACAATTTAATAGG + Intronic
1122503290 14:102215988-102216010 CAGGGAAGTGACAATTAAATGGG - Intronic
1122949034 14:105030590-105030612 CAGAGCTGTCACTATTTAAATGG + Intergenic
1124144355 15:27109570-27109592 CAGAGTTGTCATATTTAAAATGG + Intronic
1125408575 15:39380749-39380771 CAGAGATGACACAAACAAATGGG + Intergenic
1126632955 15:50756019-50756041 CAGTGCTGTGTCAATTAAGTTGG + Intronic
1128048564 15:64641703-64641725 CAGATCTCACCCAATTAAATTGG + Intronic
1128138965 15:65285492-65285514 CAAAGCTGTCACCATTTAATTGG - Intronic
1129045119 15:72727094-72727116 CAGAGCTTTCTCAATTCAACTGG - Intronic
1130951661 15:88595842-88595864 TAGACCTATAACAATTAAATTGG - Intergenic
1131710707 15:95052998-95053020 CAGAGATGACACAAGTAAATGGG - Intergenic
1131988829 15:98072280-98072302 CAGAGATGACACAAACAAATGGG - Intergenic
1134091761 16:11395336-11395358 AATAGCTGTCCCAAATAAATCGG + Intronic
1135461540 16:22647976-22647998 CAGAGATGTCACAATAACCTTGG - Intergenic
1141071451 16:80959155-80959177 CAGAGATGACACAAACAAATGGG + Intergenic
1141314007 16:82943019-82943041 CAGAGCTGTCATATTAAAATGGG - Intronic
1144039302 17:11394442-11394464 CAGAGATGACTCAATTAAAGGGG - Intronic
1144933331 17:18877881-18877903 CAGATGTTTCACAATTAATTGGG + Intronic
1146902193 17:36595952-36595974 CAGTCTTGTCACAATTAATTGGG + Intronic
1147223206 17:38952777-38952799 CAGAATTGTCACATTGAAATTGG - Intronic
1148478311 17:47943507-47943529 CAGAGCTGGAACCATAAAATTGG - Intronic
1148679218 17:49463914-49463936 CAGGGCTGTGATGATTAAATTGG + Intronic
1153081540 18:1232000-1232022 CAGAGATGACACAATCAAATGGG - Intergenic
1155262164 18:24053922-24053944 GAGAGATTTCACAATTAAAAAGG + Intronic
1159592506 18:70350635-70350657 TACAGCTGTCACATTCAAATAGG - Intronic
1159699275 18:71604380-71604402 CAGAGAAGTCAAAATTTAATAGG - Intergenic
1160253266 18:77223033-77223055 CACAGCTTACACAATTGAATCGG - Intergenic
1161244473 19:3241690-3241712 CAGAGCTCTCACAGTTGAAATGG + Intronic
925935459 2:8754051-8754073 CAGAGCTTAAACAGTTAAATAGG + Intronic
926502252 2:13670832-13670854 CAGAGATGACACAAATAAATGGG - Intergenic
927513578 2:23659310-23659332 CAGAGTTGTAAGAATTAAATGGG - Intronic
928729021 2:34209356-34209378 CAGAGATGACACAAACAAATGGG + Intergenic
929131997 2:38585436-38585458 CACAGTTGTCATAATTAAATAGG - Intronic
930839572 2:55830549-55830571 CAGAGATGACACAAACAAATGGG + Intergenic
932049181 2:68381883-68381905 CAGTGCTGTCAGAACTAAGTGGG + Intronic
937029787 2:118729136-118729158 GACAGCTGTCAAACTTAAATGGG + Intergenic
940771539 2:157844282-157844304 CAGAGCTGTCACTGTTACTTGGG - Intronic
941553485 2:166945435-166945457 GAGAGCTGTAAAAAGTAAATTGG + Intronic
941589738 2:167404398-167404420 CAGAGCTGACAAAAATAAAATGG + Intergenic
942666656 2:178326747-178326769 TATAGTTCTCACAATTAAATAGG - Intronic
943093448 2:183401139-183401161 CAGAGATGACACAAACAAATGGG - Intergenic
943270916 2:185802523-185802545 AATAGCTGCTACAATTAAATTGG - Exonic
944521293 2:200570706-200570728 CAGAGCTATCACTATTATTTGGG + Intronic
946140148 2:217683276-217683298 CACAGCTGTGACCATTAAAAGGG - Intronic
947303781 2:228720538-228720560 CAGAGCTGTCGATATTCAATCGG + Intergenic
947382830 2:229561965-229561987 CCAAGCTGTCACAATCACATTGG - Intronic
1169604056 20:7295376-7295398 TTGAGCTGTGACAATTAAACAGG - Intergenic
1170763226 20:19270022-19270044 CAGAGCAGCCCCAATGAAATGGG - Intronic
1171158760 20:22902012-22902034 CAGAGATGACACAAACAAATGGG + Intergenic
1171287028 20:23948867-23948889 CAGAGATGACACAAAGAAATGGG - Intergenic
1177129256 21:17236568-17236590 CAGAGATGGCACAATCCAATTGG - Intergenic
1178472101 21:32902985-32903007 GAGAGTTGTCAGAATTAAAATGG + Intergenic
1181620631 22:24088920-24088942 CAGAACAGTTACAATAAAATAGG - Intronic
1182806545 22:33075790-33075812 CATAGCTGTTATAATTGAATAGG + Intergenic
1183561636 22:38579286-38579308 CTGAGTTGTGAGAATTAAATGGG + Intronic
1184115860 22:42421810-42421832 GAGAGATGCCAGAATTAAATTGG - Intronic
949229939 3:1738849-1738871 CAGAGATGACACAAACAAATGGG - Intergenic
949802785 3:7921633-7921655 TAGAGCTGTGAAGATTAAATGGG - Intergenic
951309109 3:21102140-21102162 CACAGATGTCACAAACAAATGGG - Intergenic
952731427 3:36640500-36640522 AAGAACTGACACAATTGAATTGG - Intergenic
955097192 3:55811025-55811047 CAGAGCTGTCAGAAAGAACTTGG + Intronic
955724581 3:61919546-61919568 CACAGCTGTCACAATCCAGTAGG + Intronic
956151085 3:66243596-66243618 CAAAGCTGTCACAATTCGAATGG - Intronic
957446623 3:80320618-80320640 CAGCCCTATCACAATAAAATTGG + Intergenic
957606916 3:82411928-82411950 CAGAGCTGTCTCAAAATAATAGG + Intergenic
957951512 3:87133212-87133234 CAGAGATGACACAAACAAATGGG - Intergenic
958870823 3:99556843-99556865 CAGAGATGACACAAATAAAATGG + Intergenic
959274534 3:104261478-104261500 GGGAGTTTTCACAATTAAATTGG - Intergenic
960416977 3:117396927-117396949 CAAAGCTATCACAATCAACTGGG + Intergenic
961697341 3:128714602-128714624 CAAAGCTGTCACCATTTCATTGG - Intergenic
962984869 3:140526409-140526431 CAGAGATGACACAAAGAAATGGG + Intronic
966320099 3:178692895-178692917 CAGAGATGACACAAACAAATGGG - Intronic
966977908 3:185102404-185102426 CAGAGATGACACAAACAAATGGG + Intronic
967542046 3:190679481-190679503 CATGGCTGGCACATTTAAATGGG + Intergenic
968243324 3:197114056-197114078 CAGAGCTGTAAATATGAAATTGG + Intronic
969216182 4:5724139-5724161 CAGATGTGTGATAATTAAATGGG + Intronic
970624225 4:17859972-17859994 CAGAGATGACACAAACAAATGGG + Intronic
971579996 4:28324937-28324959 CAGAGATGTAGCAATTAAAATGG - Intergenic
974094519 4:57348592-57348614 CAGAGATGACACAAACAAATGGG - Intergenic
974403166 4:61429875-61429897 CACAGATGTCATAATAAAATAGG + Intronic
975014404 4:69395785-69395807 CAGGGCTGTTGCAATTACATTGG - Intronic
975428382 4:74257106-74257128 CAGAGGTGACACAAACAAATGGG - Intronic
975736200 4:77383545-77383567 CAGACATGTCACCAATAAATTGG - Intronic
976234294 4:82879629-82879651 CAGAGCTGTCACAGTGGGATGGG - Intronic
977002019 4:91516850-91516872 CAGAGATGACACAAACAAATGGG - Intronic
977621195 4:99139601-99139623 CACAGAAGTCACTATTAAATTGG - Intronic
977846062 4:101768742-101768764 TAGAGATGACACAAATAAATGGG - Intronic
979225481 4:118279267-118279289 CAAAGCTGTCACCATTTAATTGG + Intergenic
980758174 4:137192380-137192402 CAGAGCTGACATTATTAAACAGG - Intergenic
983131639 4:164027077-164027099 CAGAAATGACACAAATAAATAGG + Intronic
983629143 4:169832021-169832043 CAGAGATGACACAAGCAAATGGG + Intergenic
984011914 4:174381638-174381660 CAAAGCTGTCAGAATCAAAATGG - Intergenic
984987045 4:185341481-185341503 CAGAGGTGTGACCAATAAATGGG - Intronic
985232409 4:187834869-187834891 CATATCTATCACAATTAAAAAGG + Intergenic
986575339 5:9206877-9206899 CAAAGCTGTGAAAATTAAATGGG + Intronic
986944461 5:12999020-12999042 CAGAGTTGTGACAATCAAAAAGG - Intergenic
987140586 5:14941861-14941883 CATAGCTGCCACTATTAATTGGG + Intergenic
987260816 5:16200915-16200937 CAGAGATGACACAAAGAAATAGG + Intergenic
988193918 5:27976141-27976163 CAGAGATGGCACCAATAAATGGG - Intergenic
990056288 5:51583751-51583773 CAGAGCTGTCAGTATTGAAGTGG + Intergenic
990822029 5:59851968-59851990 CAGAGGTGTGACATGTAAATGGG + Intronic
993429686 5:87816227-87816249 CAGAGATGACACAAACAAATGGG - Intergenic
993593219 5:89821981-89822003 CAGAGATGACATAAATAAATGGG - Intergenic
994351518 5:98751801-98751823 GTGAGCTGTCATAAGTAAATGGG - Intergenic
994409084 5:99383542-99383564 CAGAGATGACACAAACAAATGGG + Intergenic
994907661 5:105861121-105861143 TAGAACTGTTACAATTTAATAGG + Intergenic
995363059 5:111320894-111320916 ATGGGCTGTCACAGTTAAATTGG + Intronic
997726643 5:136126286-136126308 CAGAGCAGCCAGAGTTAAATAGG - Intergenic
998081901 5:139282630-139282652 TATGGTTGTCACAATTAAATGGG + Intronic
998647566 5:144080197-144080219 CAGAGGTGACACAAACAAATGGG + Intergenic
999123656 5:149229997-149230019 CAGAGCTATCACATTTAAGGGGG - Intronic
999860521 5:155640737-155640759 CAGATGTGTCACATTTATATAGG + Intergenic
1004294664 6:14399716-14399738 CAAAGCATTCACAATTTAATGGG + Intergenic
1004319023 6:14618046-14618068 CAGAGCTATTAGAATTTAATAGG + Intergenic
1004929747 6:20451220-20451242 CAGAGATGACACAAACAAATGGG - Intronic
1005981136 6:30837626-30837648 TAGAGCTGTCAAAATGAAAAAGG - Intergenic
1006684958 6:35825060-35825082 CAGTGTTGTCACAGTTAAATTGG + Intronic
1010435532 6:75825745-75825767 CAGAGCTGTAATGATTAAACAGG + Intronic
1011843872 6:91537121-91537143 CAGAGGAGGAACAATTAAATGGG + Intergenic
1013022323 6:106232259-106232281 CAGAGCTGTCACTATCCAAGGGG + Intronic
1015060292 6:128956283-128956305 CAGAGCTGTGGCTGTTAAATTGG + Intronic
1015270670 6:131334963-131334985 CAGAGCTGTCAGAATAAAACAGG - Intergenic
1015534892 6:134257726-134257748 CAGAGCTGGCACAAGAATATGGG + Intronic
1016587027 6:145700156-145700178 CAGAGATGGCACATTTTAATAGG - Intronic
1016959650 6:149660329-149660351 CAGAGCTGTTGCAGTTGAATTGG - Exonic
1017833547 6:158154849-158154871 CAGCTCTGACACAGTTAAATCGG - Intronic
1020150064 7:5675089-5675111 CAGAGCTCCCACAATTTAAAAGG + Intronic
1020778387 7:12486197-12486219 CATAGCTTTCTCTATTAAATAGG + Intergenic
1022399133 7:30019592-30019614 CAGAGCTTACTCAATTATATGGG - Intronic
1024549627 7:50551653-50551675 TAGAACTCTCACAATTAAATAGG - Intronic
1025146922 7:56513218-56513240 CAGAGCTGGGATATTTAAATCGG - Intergenic
1027482937 7:78721623-78721645 CAGATTTCTCACAATTTAATAGG - Intronic
1028216457 7:88139480-88139502 CAGAGTTATCAAATTTAAATAGG - Intronic
1028654595 7:93189823-93189845 CAGAGCTGGCACATTCAAGTTGG + Intronic
1031389536 7:121196585-121196607 CCCAGCTGTGAGAATTAAATAGG + Intronic
1031523548 7:122796204-122796226 CAGAGATGACACAAACAAATAGG + Intronic
1032413781 7:131720435-131720457 GAGAGCTGTTACAGTAAAATGGG - Intergenic
1032801986 7:135324316-135324338 CAGAGCTGTGATAATTAATGGGG - Intergenic
1033104048 7:138503167-138503189 TAAAGCTGTAACAATTAAAATGG - Intronic
1034165762 7:149023866-149023888 CAGAGCTCTCATGATTAAGTGGG + Intronic
1034701605 7:153101244-153101266 CAGAAATGATACAATTAAATTGG - Intergenic
1037380644 8:18281851-18281873 GAGAGATGCCACAAATAAATAGG - Intergenic
1037869981 8:22485159-22485181 CAGAGCACCCACAATAAAATGGG - Intronic
1038624540 8:29177929-29177951 CAGTTCTGTCACAACCAAATGGG + Intronic
1039947959 8:42146257-42146279 GAGAGCTGTCATCATTAAAAGGG + Intergenic
1042108209 8:65351431-65351453 CAGAGATGACACAAACAAATAGG - Intergenic
1042245175 8:66702800-66702822 CAGACTTTTCACAATTAAAAGGG - Intronic
1043607924 8:82025382-82025404 TGAAGCTGTCACCATTAAATTGG - Intergenic
1046736301 8:117779654-117779676 CAGAGATGACACAAACAAATGGG + Intergenic
1047068606 8:121316335-121316357 CAGAGTTATAAGAATTAAATTGG + Intergenic
1047906373 8:129477237-129477259 CAGAACTGTGAGAAATAAATGGG + Intergenic
1048846203 8:138605593-138605615 CAGAGGGGTCAGAATTAAATTGG + Intronic
1050654813 9:7816050-7816072 AAAAGATGTCAAAATTAAATGGG - Intronic
1051135386 9:13914454-13914476 ACTAGCTGTCACAATGAAATGGG + Intergenic
1051639792 9:19214035-19214057 CAGAGCTTTAAATATTAAATAGG - Intergenic
1052247331 9:26351789-26351811 CACAGATGACACAAATAAATGGG + Intergenic
1056010345 9:82322823-82322845 CAGAGATGACACAAACAAATGGG - Intergenic
1057735860 9:97659496-97659518 CAGAGTTGACATAATGAAATAGG - Intronic
1059017520 9:110535654-110535676 CAGAGATGACACAAACAAATGGG - Intronic
1186950585 X:14620245-14620267 CAGCACTGTCACAACTAATTTGG + Intronic
1189889738 X:45588163-45588185 CAGAGCTATCATAATCAAAATGG - Intergenic
1191171992 X:57457792-57457814 CAGAGGTAACACAAATAAATGGG + Intronic
1193725658 X:85036123-85036145 CAGAGATGACACAAACAAATGGG - Intronic
1193892803 X:87071659-87071681 CAGCCCTGTCACAATTTTATTGG - Intergenic
1194126562 X:90025264-90025286 CAGAGATGACACAAACAAATGGG + Intergenic
1195489960 X:105455966-105455988 CAGAGATGACACAAACAAATGGG - Intronic
1197812480 X:130459179-130459201 AATAGCTGCCACAATTAAATTGG + Intergenic
1199400558 X:147394248-147394270 CAGAGATGACACAAAAAAATGGG + Intergenic
1199952933 X:152719519-152719541 CAGAGCTGACTCCATTAAAAAGG + Intergenic
1199955461 X:152738265-152738287 CAGAGCTGACTCCATTAAAAAGG + Intergenic
1199956750 X:152748927-152748949 CAGAGCTGACTCCATTAAAAAGG - Intergenic
1200316561 X:155138630-155138652 AAAAGCTGTCACAATAAACTAGG + Intronic
1201864149 Y:18631378-18631400 CATGGGTGTCACATTTAAATGGG + Intergenic
1201869173 Y:18689000-18689022 CATGGGTGTCACATTTAAATGGG - Intergenic