ID: 1098844311

View in Genome Browser
Species Human (GRCh38)
Location 12:75517174-75517196
Sequence CACGGTAACCAGAGGGTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098844305_1098844311 3 Left 1098844305 12:75517148-75517170 CCTTTGGAATTAAAGACCTTAAT No data
Right 1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG No data
1098844304_1098844311 18 Left 1098844304 12:75517133-75517155 CCTCACAACAACTCTCCTTTGGA No data
Right 1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098844311 Original CRISPR CACGGTAACCAGAGGGTAGA GGG Intergenic
No off target data available for this crispr