ID: 1098845795

View in Genome Browser
Species Human (GRCh38)
Location 12:75534209-75534231
Sequence TCATTAAATGCAGTATTTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098845795_1098845798 28 Left 1098845795 12:75534209-75534231 CCTACAAATACTGCATTTAATGA No data
Right 1098845798 12:75534260-75534282 AACTTGCAGTGTAGACGTGAAGG No data
1098845795_1098845799 29 Left 1098845795 12:75534209-75534231 CCTACAAATACTGCATTTAATGA No data
Right 1098845799 12:75534261-75534283 ACTTGCAGTGTAGACGTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098845795 Original CRISPR TCATTAAATGCAGTATTTGT AGG (reversed) Intergenic
No off target data available for this crispr