ID: 1098845798

View in Genome Browser
Species Human (GRCh38)
Location 12:75534260-75534282
Sequence AACTTGCAGTGTAGACGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098845796_1098845798 -8 Left 1098845796 12:75534245-75534267 CCTAACCTGCATATGAACTTGCA No data
Right 1098845798 12:75534260-75534282 AACTTGCAGTGTAGACGTGAAGG No data
1098845795_1098845798 28 Left 1098845795 12:75534209-75534231 CCTACAAATACTGCATTTAATGA No data
Right 1098845798 12:75534260-75534282 AACTTGCAGTGTAGACGTGAAGG No data
1098845794_1098845798 29 Left 1098845794 12:75534208-75534230 CCCTACAAATACTGCATTTAATG No data
Right 1098845798 12:75534260-75534282 AACTTGCAGTGTAGACGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098845798 Original CRISPR AACTTGCAGTGTAGACGTGA AGG Intergenic
No off target data available for this crispr