ID: 1098851412

View in Genome Browser
Species Human (GRCh38)
Location 12:75600649-75600671
Sequence CACCTGATGAAACATGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098851412 Original CRISPR CACCTGATGAAACATGTGCT GGG Intergenic
901599455 1:10411505-10411527 CACCTGATGAAAGACGTGCTGGG + Exonic
902855675 1:19202772-19202794 CAATTGATGAAACATGGGCCGGG + Intronic
908912902 1:69093174-69093196 CACATGATTAAATATGAGCTTGG - Intergenic
910431158 1:87160898-87160920 CAGCTGATGGAACATGTGAAAGG + Intronic
912210487 1:107551655-107551677 CCTCTGATGAACCATCTGCTAGG + Intergenic
917068803 1:171126705-171126727 CACATGAAGAAACTTGTTCTAGG + Intergenic
921583337 1:216921194-216921216 CTCCTGATGAAAGATGTGTCTGG - Intronic
924584888 1:245353532-245353554 CACCTCATGAATCATGACCTGGG - Intronic
1062791290 10:308004-308026 CTCCAGATGGACCATGTGCTGGG - Intronic
1063072308 10:2679390-2679412 CACCTGATTAACTATGTGCTTGG - Intergenic
1069936235 10:71919151-71919173 CACATGTTGAAAAATGTCCTTGG - Intergenic
1070718445 10:78739602-78739624 CACCTGTGGAATCATGTGCATGG + Intergenic
1071472556 10:85994069-85994091 CAGCTAATCAAACATGTCCTGGG + Intronic
1076348816 10:129800741-129800763 CCCCTGATGAAACTTGGGATAGG + Intergenic
1076455129 10:130587194-130587216 CACCCGATGAGCCGTGTGCTAGG + Intergenic
1077005028 11:350887-350909 CACGTGTTGAAACTTGTGGTTGG - Intergenic
1080288285 11:30641285-30641307 CACATGTTGAAAAATGTCCTTGG + Intergenic
1081766446 11:45614458-45614480 CAGCCAATGAAACATTTGCTGGG + Intergenic
1082652495 11:55810745-55810767 GACCTGATCAAAGATGTGCATGG - Intergenic
1082809621 11:57471553-57471575 CAGGTGAGGAAACATGGGCTGGG + Intronic
1082821665 11:57548110-57548132 CACCTGATAAAGCATGAGGTGGG + Intronic
1086087346 11:82968869-82968891 ATCTTGATGAAACATGTTCTAGG - Intronic
1088192225 11:107238839-107238861 CAATTGATGAAATATGTGTTGGG - Intergenic
1089465083 11:118679740-118679762 CACCTGAGGGGACGTGTGCTTGG + Intergenic
1090116363 11:123978440-123978462 CACCTAATGCAACATCTGTTAGG - Intergenic
1093394222 12:18660837-18660859 GACCTGATGAAATATTTACTAGG + Intergenic
1094054009 12:26250119-26250141 AACCTAATGAAACAAGTACTGGG - Intronic
1095142630 12:38685269-38685291 CAAGTGAAGAAACATTTGCTGGG - Intronic
1096814197 12:54191408-54191430 CAAGAGATGAAACATGGGCTTGG + Intergenic
1098335932 12:69404477-69404499 CTCCTGATGAAAGATGAGTTTGG + Intergenic
1098851412 12:75600649-75600671 CACCTGATGAAACATGTGCTGGG + Intergenic
1099070192 12:78036528-78036550 CTCCTGCTGAGACATGTGATTGG + Intronic
1106329191 13:28723603-28723625 CACCTGACGACACCTGTGTTTGG - Intergenic
1106694073 13:32151481-32151503 CACTTGATGAAACATGCTGTAGG + Intronic
1107103738 13:36622040-36622062 CACCAGATGGAACATATTCTGGG + Intergenic
1109911328 13:68914921-68914943 GTCCTGAAAAAACATGTGCTAGG + Intergenic
1110879040 13:80547550-80547572 CATTTGTTGAATCATGTGCTTGG + Intergenic
1111339833 13:86869425-86869447 CAACTGATGGAAGATGTGGTAGG - Intergenic
1114597270 14:23924288-23924310 CTCCTGTTGAAAAGTGTGCTTGG + Intergenic
1115755581 14:36524014-36524036 CAGCTCAGGAAACAGGTGCTCGG - Intergenic
1116167047 14:41347924-41347946 CTCCTGATGAAATATGTCTTAGG - Intergenic
1117791574 14:59347604-59347626 CACCTGTTCCAACATGTCCTTGG - Exonic
1118537997 14:66790597-66790619 CACATGCTGAAAAATGTCCTTGG - Intronic
1119880467 14:78095603-78095625 CACCATATGAAACATGTTCCTGG + Intergenic
1121981351 14:98457234-98457256 CACGTGCTGACACCTGTGCTGGG + Intergenic
1124665707 15:31590328-31590350 TACCTTATGAGACATGTGATTGG - Intronic
1128552563 15:68607969-68607991 CACCTCATGAAACAGGGCCTTGG + Intronic
1128698394 15:69786305-69786327 CAACTGAGGAAACAAGTGCCAGG - Intergenic
1130370194 15:83279301-83279323 AACTTGATGTAATATGTGCTTGG - Intronic
1131431634 15:92393418-92393440 CAACTGCTGAAACATCTGCCTGG + Intergenic
1131640919 15:94292547-94292569 AACCTAATAAAACATGTACTGGG + Intronic
1132237164 15:100230838-100230860 CACCTCCTGAAACAGGTGTTGGG + Intronic
1137402707 16:48166216-48166238 TTCCTGATCAATCATGTGCTAGG - Intergenic
1137712792 16:50578298-50578320 ACCCTGATGAAAGAGGTGCTGGG + Intronic
1139412002 16:66769843-66769865 GACATGATGAAACATGGTCTTGG - Intronic
1141343200 16:83222579-83222601 CACCTGATTAGACTTGTACTTGG + Intronic
1143205318 17:5136715-5136737 CACCTGATGCCACATGGTCTTGG - Exonic
1144876365 17:18399408-18399430 CACCTGATGCCACATGGTCTTGG - Intergenic
1145155862 17:20545012-20545034 CACCTGATGCCACATGGTCTTGG + Intergenic
1145761011 17:27425549-27425571 CACCAGATGACACATGGTCTTGG - Intergenic
1146754124 17:35411322-35411344 CACCTGATGGAAAATGGACTGGG - Exonic
1147001056 17:37362663-37362685 CACCTGATGAAACAAACACTAGG + Intronic
1147018864 17:37514591-37514613 CACCTGGTGACAGATGTTCTTGG + Intergenic
1147165812 17:38592678-38592700 TACATGATGACACATGTGCCAGG - Intronic
1151181157 17:72329659-72329681 CAGCAGATGAGACATGGGCTAGG - Intergenic
1155957017 18:31962776-31962798 CACCTGATGAAAGACGTGCTGGG + Intergenic
1160328066 18:77968611-77968633 CACCTGATGAAACAAGCTCACGG - Intergenic
1160372022 18:78381432-78381454 CACCTTGTGAAAAAGGTGCTTGG + Intergenic
1160486797 18:79300454-79300476 CACCTGCTGAGACATCTGCAAGG - Intronic
1162264015 19:9555235-9555257 AACGTGATGAAAAGTGTGCTTGG + Intergenic
1166900968 19:46062588-46062610 CACATGTTGAAAGATGTCCTTGG - Intronic
925043185 2:749780-749802 CAGCTGATGAAGGAAGTGCTGGG + Intergenic
932838349 2:75058557-75058579 CACCTGGTGAGATATGTGCTGGG + Intronic
933261784 2:80139302-80139324 CACCTGATGAAAAATGACCATGG + Intronic
933788053 2:85859556-85859578 CACCTGAGGACACCTATGCTGGG + Intronic
935148743 2:100414835-100414857 TACCTGCTGAGACCTGTGCTTGG - Intronic
935472760 2:103479689-103479711 CACATGTTGAAAAATGTCCTTGG - Intergenic
935885794 2:107617707-107617729 CACATGTTGAAAAATGTCCTTGG + Intergenic
936158880 2:110069319-110069341 CACATGTGGATACATGTGCTTGG - Intergenic
936185780 2:110302013-110302035 CACATGTGGATACATGTGCTTGG + Intergenic
938052437 2:128186690-128186712 CACCTGATGAATCATGTTATTGG - Exonic
940180268 2:150924030-150924052 CACCTCATGGGACATCTGCTGGG - Intergenic
942936240 2:181559926-181559948 CACCTAATCAAACATGACCTGGG - Intronic
943444666 2:187969406-187969428 CACCAGTTTAAACATATGCTGGG + Intergenic
1174932764 20:54833484-54833506 CACCAGATGAAGAAGGTGCTTGG + Intergenic
1177360831 21:20067107-20067129 CAGGTGATGAAACATGTTCAAGG - Intergenic
1177997704 21:28121965-28121987 CACCTGATGAAACATGGTCCAGG + Intergenic
1180242918 21:46523836-46523858 CACATGTTGAAAAATGTCCTTGG - Intronic
1182960755 22:34472666-34472688 CACCTGTTTAACCATGTACTTGG + Intergenic
1183300239 22:37055425-37055447 CACCTGCTGAAAACTGTGATGGG - Intronic
1185131564 22:49042210-49042232 CACCTGAGGAATCACCTGCTTGG - Intergenic
950153623 3:10707230-10707252 CACCTGGTGACACAAGAGCTCGG - Intronic
954664602 3:52245301-52245323 CGCCTGAAGGAACCTGTGCTCGG + Intergenic
960057741 3:113287202-113287224 CTCGTGATGAACCATGTGCCTGG - Exonic
961774112 3:129271890-129271912 CACCTGAAAAACCATGTGGTTGG - Exonic
962602069 3:136999535-136999557 TACCTGAAGAAATATGGGCTGGG - Intronic
963289994 3:143477770-143477792 CAGCTGAGGAAGCAGGTGCTGGG + Intronic
963533156 3:146496914-146496936 CACTTTATGAAAGATGAGCTTGG + Intergenic
966960049 3:184926418-184926440 CACCTGATGTTACATGTACTGGG + Intronic
969488766 4:7486810-7486832 CTCGTGAGGACACATGTGCTTGG + Intronic
969671248 4:8591503-8591525 CCCCTGATGAACCATTTGGTGGG + Intronic
970080286 4:12275964-12275986 CACATGATGGAACTTGTGATTGG - Intergenic
975979897 4:80145368-80145390 CATCTGATGAAACTTGTGGTGGG - Intergenic
977589816 4:98813771-98813793 CACGTGTTGAAAAATGTTCTTGG + Intergenic
978901553 4:113956208-113956230 TACTTTATGAAACATGTGCTTGG + Intronic
979838322 4:125403246-125403268 CAGATGAGGAAACATGGGCTTGG + Intronic
985725756 5:1515069-1515091 CCCCTGATGCAGGATGTGCTGGG - Intronic
985725779 5:1515165-1515187 CCCCTGATGCAGGATGTGCTGGG - Intronic
985725803 5:1515261-1515283 CCCCTGATGCAGGATGTGCTGGG - Intronic
987535797 5:19185435-19185457 CACCTGATGAAACCTATCCCAGG + Intergenic
992504921 5:77377403-77377425 AACCTGCTGAAACAAGTGATGGG + Intronic
995137258 5:108693142-108693164 CACCTGGTTAAACATTTTCTGGG - Intergenic
995895378 5:117005159-117005181 CACATGTTGAAAAATGTCCTTGG - Intergenic
997389184 5:133499672-133499694 CAACTGATTAATCCTGTGCTGGG + Intronic
1003046581 6:2739028-2739050 CAACATATGAAACAGGTGCTTGG - Intronic
1004916796 6:20340154-20340176 CACCTCGTGGAACATGTGATTGG + Intergenic
1005947328 6:30603939-30603961 CTCCTGAGGGAACATGAGCTGGG - Intronic
1007373813 6:41443220-41443242 CACCTGGAGAAACAGGAGCTGGG + Intergenic
1014097641 6:117478083-117478105 CACATGTTGAAAAATGTCCTTGG - Intronic
1016296151 6:142575289-142575311 CACATGTTGAAAAATGTCCTTGG + Intergenic
1018078177 6:160234595-160234617 CACATGTTGAAAAATGTCCTTGG + Intronic
1018138281 6:160800089-160800111 CACATGATGAAACAGGAGGTTGG + Intergenic
1020598332 7:10240607-10240629 CAACTGAAGAAACATGTACTAGG - Intergenic
1024123409 7:46267628-46267650 CACCTGCTGAAAAATATCCTGGG + Intergenic
1028149397 7:87354372-87354394 AACCTGATGAAAAAAGTGCTTGG + Intronic
1032613267 7:133439476-133439498 GAACTGATGAAATATGGGCTGGG - Intronic
1036721468 8:11179600-11179622 CCCCTGATGAAACCTGAGTTGGG - Intronic
1037483187 8:19324210-19324232 GACCCCATGAAACAAGTGCTGGG - Intronic
1038956288 8:32472039-32472061 CACCTGATGAGATATTGGCTGGG - Intronic
1041595652 8:59647937-59647959 CAACAGATGAAAAAAGTGCTAGG - Intergenic
1044599449 8:93989248-93989270 CACCTAATGAAATATATGATAGG + Intergenic
1044782046 8:95753073-95753095 CACATGAACAAATATGTGCTTGG - Intergenic
1050173708 9:2848874-2848896 CACCTAATAAAATATATGCTTGG - Intergenic
1050272953 9:3965619-3965641 CTCCTGACGAAACATGTGCATGG + Intronic
1051441172 9:17084866-17084888 CAACTGATGATTCATGTCCTGGG - Intergenic
1059951931 9:119474541-119474563 CACGAGATAAAACACGTGCTTGG + Intergenic
1059987879 9:119837464-119837486 CAGCTGAGGAAACAGGTTCTGGG + Intergenic
1060349659 9:122848170-122848192 CACCTGGTGAAAGATCAGCTTGG + Exonic
1061970015 9:134039873-134039895 GGCCTGATGAGACCTGTGCTGGG - Intronic
1187361884 X:18636037-18636059 CTCCTGATTGAACATGTACTCGG - Intronic
1190278533 X:48914392-48914414 CACCTGGGGAGACATGGGCTGGG + Exonic
1192185021 X:68940871-68940893 CAGCTGATCAAACACATGCTAGG - Intergenic
1195877015 X:109552122-109552144 CACATGTTGAAAAATGTCCTTGG + Intergenic
1196288259 X:113908292-113908314 CAGCAGATGAAATATATGCTTGG - Intergenic
1200917201 Y:8581793-8581815 CACCTTATGAAGCACCTGCTTGG - Intergenic