ID: 1098856823

View in Genome Browser
Species Human (GRCh38)
Location 12:75662466-75662488
Sequence CTGTATTAGCAGTGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098856823_1098856825 -6 Left 1098856823 12:75662466-75662488 CCATTTTCACACTGCTAATACAG No data
Right 1098856825 12:75662483-75662505 ATACAGACATACCCAAGCCTGGG No data
1098856823_1098856831 22 Left 1098856823 12:75662466-75662488 CCATTTTCACACTGCTAATACAG No data
Right 1098856831 12:75662511-75662533 TACAAAGGAAAGAGGTTTAATGG No data
1098856823_1098856830 14 Left 1098856823 12:75662466-75662488 CCATTTTCACACTGCTAATACAG No data
Right 1098856830 12:75662503-75662525 GGGCAATTTACAAAGGAAAGAGG No data
1098856823_1098856828 7 Left 1098856823 12:75662466-75662488 CCATTTTCACACTGCTAATACAG No data
Right 1098856828 12:75662496-75662518 CAAGCCTGGGCAATTTACAAAGG No data
1098856823_1098856824 -7 Left 1098856823 12:75662466-75662488 CCATTTTCACACTGCTAATACAG No data
Right 1098856824 12:75662482-75662504 AATACAGACATACCCAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098856823 Original CRISPR CTGTATTAGCAGTGTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr