ID: 1098859366

View in Genome Browser
Species Human (GRCh38)
Location 12:75690084-75690106
Sequence CTCAGGATTTACTTCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098859366_1098859370 -9 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859370 12:75690098-75690120 AATCCTGAGACAAGAAAGGAGGG No data
1098859366_1098859373 -3 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859373 12:75690104-75690126 GAGACAAGAAAGGAGGGCTTGGG No data
1098859366_1098859372 -4 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859372 12:75690103-75690125 TGAGACAAGAAAGGAGGGCTTGG No data
1098859366_1098859369 -10 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859369 12:75690097-75690119 AAATCCTGAGACAAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098859366 Original CRISPR CTCAGGATTTACTTCCTTGT GGG (reversed) Intergenic