ID: 1098859369

View in Genome Browser
Species Human (GRCh38)
Location 12:75690097-75690119
Sequence AAATCCTGAGACAAGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098859364_1098859369 5 Left 1098859364 12:75690069-75690091 CCTATTATCAATTATCCCACAAG No data
Right 1098859369 12:75690097-75690119 AAATCCTGAGACAAGAAAGGAGG No data
1098859362_1098859369 26 Left 1098859362 12:75690048-75690070 CCCTAAAATAAAATTGATGTTCC No data
Right 1098859369 12:75690097-75690119 AAATCCTGAGACAAGAAAGGAGG No data
1098859363_1098859369 25 Left 1098859363 12:75690049-75690071 CCTAAAATAAAATTGATGTTCCT No data
Right 1098859369 12:75690097-75690119 AAATCCTGAGACAAGAAAGGAGG No data
1098859366_1098859369 -10 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859369 12:75690097-75690119 AAATCCTGAGACAAGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098859369 Original CRISPR AAATCCTGAGACAAGAAAGG AGG Intergenic