ID: 1098859373

View in Genome Browser
Species Human (GRCh38)
Location 12:75690104-75690126
Sequence GAGACAAGAAAGGAGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098859366_1098859373 -3 Left 1098859366 12:75690084-75690106 CCCACAAGGAAGTAAATCCTGAG No data
Right 1098859373 12:75690104-75690126 GAGACAAGAAAGGAGGGCTTGGG No data
1098859367_1098859373 -4 Left 1098859367 12:75690085-75690107 CCACAAGGAAGTAAATCCTGAGA No data
Right 1098859373 12:75690104-75690126 GAGACAAGAAAGGAGGGCTTGGG No data
1098859364_1098859373 12 Left 1098859364 12:75690069-75690091 CCTATTATCAATTATCCCACAAG No data
Right 1098859373 12:75690104-75690126 GAGACAAGAAAGGAGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098859373 Original CRISPR GAGACAAGAAAGGAGGGCTT GGG Intergenic