ID: 1098867547

View in Genome Browser
Species Human (GRCh38)
Location 12:75780192-75780214
Sequence GGCTAATGAGACTGGACAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867539_1098867547 27 Left 1098867539 12:75780142-75780164 CCTTTGCAATCTTCAGCTGCCTT No data
Right 1098867547 12:75780192-75780214 GGCTAATGAGACTGGACAGGAGG No data
1098867541_1098867547 4 Left 1098867541 12:75780165-75780187 CCGACTACGTCATTATCACCATT No data
Right 1098867547 12:75780192-75780214 GGCTAATGAGACTGGACAGGAGG No data
1098867540_1098867547 8 Left 1098867540 12:75780161-75780183 CCTTCCGACTACGTCATTATCAC No data
Right 1098867547 12:75780192-75780214 GGCTAATGAGACTGGACAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867547 Original CRISPR GGCTAATGAGACTGGACAGG AGG Intergenic
No off target data available for this crispr