ID: 1098867713

View in Genome Browser
Species Human (GRCh38)
Location 12:75781726-75781748
Sequence AGGATTATGCACATTTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867713_1098867717 14 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867717 12:75781763-75781785 ACTTTTCTCAATTCTAGAATGGG No data
1098867713_1098867716 13 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867716 12:75781762-75781784 GACTTTTCTCAATTCTAGAATGG No data
1098867713_1098867719 20 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data
1098867713_1098867718 15 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867718 12:75781764-75781786 CTTTTCTCAATTCTAGAATGGGG No data
1098867713_1098867720 26 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867720 12:75781775-75781797 TCTAGAATGGGGTATGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867713 Original CRISPR AGGATTATGCACATTTCTGG AGG (reversed) Intergenic
No off target data available for this crispr