ID: 1098867714

View in Genome Browser
Species Human (GRCh38)
Location 12:75781729-75781751
Sequence CACAGGATTATGCACATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867714_1098867717 11 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867717 12:75781763-75781785 ACTTTTCTCAATTCTAGAATGGG No data
1098867714_1098867720 23 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867720 12:75781775-75781797 TCTAGAATGGGGTATGGAGAAGG No data
1098867714_1098867718 12 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867718 12:75781764-75781786 CTTTTCTCAATTCTAGAATGGGG No data
1098867714_1098867719 17 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data
1098867714_1098867716 10 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867716 12:75781762-75781784 GACTTTTCTCAATTCTAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867714 Original CRISPR CACAGGATTATGCACATTTC TGG (reversed) Intergenic
No off target data available for this crispr