ID: 1098867715

View in Genome Browser
Species Human (GRCh38)
Location 12:75781746-75781768
Sequence AAAAGTCAGACTCATGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867715_1098867722 28 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867722 12:75781797-75781819 GTAATCTTATCTAGACCTCAGGG No data
1098867715_1098867716 -7 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867716 12:75781762-75781784 GACTTTTCTCAATTCTAGAATGG No data
1098867715_1098867718 -5 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867718 12:75781764-75781786 CTTTTCTCAATTCTAGAATGGGG No data
1098867715_1098867723 29 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867723 12:75781798-75781820 TAATCTTATCTAGACCTCAGGGG No data
1098867715_1098867721 27 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867721 12:75781796-75781818 GGTAATCTTATCTAGACCTCAGG No data
1098867715_1098867720 6 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867720 12:75781775-75781797 TCTAGAATGGGGTATGGAGAAGG No data
1098867715_1098867717 -6 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867717 12:75781763-75781785 ACTTTTCTCAATTCTAGAATGGG No data
1098867715_1098867719 0 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867715 Original CRISPR AAAAGTCAGACTCATGACAC AGG (reversed) Intergenic
No off target data available for this crispr