ID: 1098867719

View in Genome Browser
Species Human (GRCh38)
Location 12:75781769-75781791
Sequence CTCAATTCTAGAATGGGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867712_1098867719 21 Left 1098867712 12:75781725-75781747 CCCTCCAGAAATGTGCATAATCC No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data
1098867715_1098867719 0 Left 1098867715 12:75781746-75781768 CCTGTGTCATGAGTCTGACTTTT No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data
1098867714_1098867719 17 Left 1098867714 12:75781729-75781751 CCAGAAATGTGCATAATCCTGTG No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data
1098867713_1098867719 20 Left 1098867713 12:75781726-75781748 CCTCCAGAAATGTGCATAATCCT No data
Right 1098867719 12:75781769-75781791 CTCAATTCTAGAATGGGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867719 Original CRISPR CTCAATTCTAGAATGGGGTA TGG Intergenic
No off target data available for this crispr