ID: 1098867892

View in Genome Browser
Species Human (GRCh38)
Location 12:75783449-75783471
Sequence CTGTTCACCTTAAGCACAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098867889_1098867892 1 Left 1098867889 12:75783425-75783447 CCCCTCTGTTAAAAGGAGAGACG No data
Right 1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG No data
1098867891_1098867892 -1 Left 1098867891 12:75783427-75783449 CCTCTGTTAAAAGGAGAGACGTC No data
Right 1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG No data
1098867890_1098867892 0 Left 1098867890 12:75783426-75783448 CCCTCTGTTAAAAGGAGAGACGT No data
Right 1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG No data
1098867886_1098867892 13 Left 1098867886 12:75783413-75783435 CCTGGGTTCCTGCCCCTCTGTTA No data
Right 1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG No data
1098867888_1098867892 5 Left 1098867888 12:75783421-75783443 CCTGCCCCTCTGTTAAAAGGAGA No data
Right 1098867892 12:75783449-75783471 CTGTTCACCTTAAGCACAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098867892 Original CRISPR CTGTTCACCTTAAGCACAAA CGG Intergenic
No off target data available for this crispr