ID: 1098873856 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 12:75846449-75846471 |
| Sequence | ACTCCTTCATGAAGCTCTAA GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1098873849_1098873856 | 30 | Left | 1098873849 | 12:75846396-75846418 | CCAGAGTCTGAAATCAGATCACT | No data | ||
| Right | 1098873856 | 12:75846449-75846471 | ACTCCTTCATGAAGCTCTAAGGG | No data | ||||
| 1098873853_1098873856 | -2 | Left | 1098873853 | 12:75846428-75846450 | CCAAGGTGTCAACACAGCCATAC | No data | ||
| Right | 1098873856 | 12:75846449-75846471 | ACTCCTTCATGAAGCTCTAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1098873856 | Original CRISPR | ACTCCTTCATGAAGCTCTAA GGG | Intergenic | ||