ID: 1098873856

View in Genome Browser
Species Human (GRCh38)
Location 12:75846449-75846471
Sequence ACTCCTTCATGAAGCTCTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098873849_1098873856 30 Left 1098873849 12:75846396-75846418 CCAGAGTCTGAAATCAGATCACT No data
Right 1098873856 12:75846449-75846471 ACTCCTTCATGAAGCTCTAAGGG No data
1098873853_1098873856 -2 Left 1098873853 12:75846428-75846450 CCAAGGTGTCAACACAGCCATAC No data
Right 1098873856 12:75846449-75846471 ACTCCTTCATGAAGCTCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098873856 Original CRISPR ACTCCTTCATGAAGCTCTAA GGG Intergenic