ID: 1098877392

View in Genome Browser
Species Human (GRCh38)
Location 12:75880652-75880674
Sequence CCTAAAAAGCAGACAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098877386_1098877392 26 Left 1098877386 12:75880603-75880625 CCATAGTACAATCCTCCTTCTAG No data
Right 1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG No data
1098877388_1098877392 14 Left 1098877388 12:75880615-75880637 CCTCCTTCTAGGAAATCATGTGG No data
Right 1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG No data
1098877390_1098877392 11 Left 1098877390 12:75880618-75880640 CCTTCTAGGAAATCATGTGGTGA No data
Right 1098877392 12:75880652-75880674 CCTAAAAAGCAGACAGTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098877392 Original CRISPR CCTAAAAAGCAGACAGTTCA TGG Intergenic
No off target data available for this crispr