ID: 1098877417

View in Genome Browser
Species Human (GRCh38)
Location 12:75880846-75880868
Sequence GGTTCCACACAACCATAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098877417_1098877422 15 Left 1098877417 12:75880846-75880868 CCCCCTTATGGTTGTGTGGAACC No data
Right 1098877422 12:75880884-75880906 GCCAGTGACTTGTGAGCCAAAGG No data
1098877417_1098877424 16 Left 1098877417 12:75880846-75880868 CCCCCTTATGGTTGTGTGGAACC No data
Right 1098877424 12:75880885-75880907 CCAGTGACTTGTGAGCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098877417 Original CRISPR GGTTCCACACAACCATAAGG GGG (reversed) Intergenic
No off target data available for this crispr