ID: 1098878540

View in Genome Browser
Species Human (GRCh38)
Location 12:75892262-75892284
Sequence GGGGGATCCTTGAGAAAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098878537_1098878540 -5 Left 1098878537 12:75892244-75892266 CCCTGGCATAGGGTAGAGGGGGG No data
Right 1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG No data
1098878527_1098878540 15 Left 1098878527 12:75892224-75892246 CCCTCAAACATAGTAGATTCCCC No data
Right 1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG No data
1098878528_1098878540 14 Left 1098878528 12:75892225-75892247 CCTCAAACATAGTAGATTCCCCT No data
Right 1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG No data
1098878535_1098878540 -4 Left 1098878535 12:75892243-75892265 CCCCTGGCATAGGGTAGAGGGGG No data
Right 1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG No data
1098878539_1098878540 -6 Left 1098878539 12:75892245-75892267 CCTGGCATAGGGTAGAGGGGGGA No data
Right 1098878540 12:75892262-75892284 GGGGGATCCTTGAGAAAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098878540 Original CRISPR GGGGGATCCTTGAGAAAAAC TGG Intergenic
No off target data available for this crispr