ID: 1098880314

View in Genome Browser
Species Human (GRCh38)
Location 12:75910479-75910501
Sequence CAGAGCTGTCATTCACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098880307_1098880314 16 Left 1098880307 12:75910440-75910462 CCCCTGCTGCCTGCTGTTCCACA No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data
1098880309_1098880314 14 Left 1098880309 12:75910442-75910464 CCTGCTGCCTGCTGTTCCACAGA No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data
1098880310_1098880314 7 Left 1098880310 12:75910449-75910471 CCTGCTGTTCCACAGAAATTGAT No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data
1098880306_1098880314 21 Left 1098880306 12:75910435-75910457 CCATGCCCCTGCTGCCTGCTGTT No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data
1098880311_1098880314 -2 Left 1098880311 12:75910458-75910480 CCACAGAAATTGATTAAAACCCA No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data
1098880308_1098880314 15 Left 1098880308 12:75910441-75910463 CCCTGCTGCCTGCTGTTCCACAG No data
Right 1098880314 12:75910479-75910501 CAGAGCTGTCATTCACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098880314 Original CRISPR CAGAGCTGTCATTCACAAGT TGG Intergenic
No off target data available for this crispr