ID: 1098886384

View in Genome Browser
Species Human (GRCh38)
Location 12:75964780-75964802
Sequence TTAAGCCAGAGGTTCCAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 121}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098886384_1098886387 12 Left 1098886384 12:75964780-75964802 CCAAATTGGAACCTCTGGCTTAA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1098886387 12:75964815-75964837 TTCTTCAGTATTAGTGAGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 186
1098886384_1098886388 20 Left 1098886384 12:75964780-75964802 CCAAATTGGAACCTCTGGCTTAA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1098886388 12:75964823-75964845 TATTAGTGAGCAGGGAGATCAGG 0: 1
1: 0
2: 2
3: 9
4: 139
1098886384_1098886386 11 Left 1098886384 12:75964780-75964802 CCAAATTGGAACCTCTGGCTTAA 0: 1
1: 0
2: 0
3: 11
4: 121
Right 1098886386 12:75964814-75964836 TTTCTTCAGTATTAGTGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098886384 Original CRISPR TTAAGCCAGAGGTTCCAATT TGG (reversed) Intergenic
903303106 1:22392965-22392987 TTAAGTCAGAGTCTCCACTTTGG - Intergenic
903413338 1:23164976-23164998 TTAAGACAGAGGATACATTTTGG - Intronic
906690521 1:47789825-47789847 ATAAGCCTGAGGTTCCAAGAAGG - Intronic
908325363 1:63018141-63018163 TTAAGTCACAGGATCCAATATGG - Intergenic
917285966 1:173421785-173421807 TTAAGCCAGAAGAACAAATTGGG - Intergenic
917398869 1:174623954-174623976 TTAAGCCATTGGTTCCAGTTTGG - Intronic
917569571 1:176251119-176251141 TAAATCCAGAGGTTGCATTTTGG + Intergenic
1063669419 10:8087968-8087990 TTAAACCAGAGCTTCCAAATTGG - Intergenic
1064062463 10:12149620-12149642 TCAAACCAGATGTTACAATTGGG - Exonic
1066009896 10:31184983-31185005 TAAATACAAAGGTTCCAATTTGG + Intergenic
1067905294 10:50284551-50284573 TTTAGCAAGTGGTTCCATTTGGG + Intergenic
1071471202 10:85985149-85985171 GTATGCCAGTGGTTCTAATTTGG - Intronic
1073265392 10:102225321-102225343 TAGAGCCAGAGGATCCAAGTAGG - Intergenic
1078305505 11:10181111-10181133 CTAAGCCCTAGATTCCAATTAGG - Intronic
1078799026 11:14624307-14624329 TTTAGCCAAAGGTACCAACTGGG + Intronic
1079920447 11:26427463-26427485 AAAAGCAAGAGGTTCCATTTTGG - Intronic
1080915535 11:36654614-36654636 TGAAGCTAGAGATACCAATTTGG - Intronic
1082777197 11:57255092-57255114 TTAAGGCAGAGGTTCCACACTGG + Intergenic
1089725857 11:120479252-120479274 TTAGGCAACAGGTTCCACTTAGG - Intronic
1098886384 12:75964780-75964802 TTAAGCCAGAGGTTCCAATTTGG - Intergenic
1099232101 12:80038923-80038945 TGAAGCCAGAGTTTCCAACTAGG - Intergenic
1103262917 12:119604181-119604203 TTAAGCCAGACTTTCCAACATGG + Intronic
1104101647 12:125618207-125618229 ATAGGCCATAAGTTCCAATTTGG - Intronic
1110843391 13:80167901-80167923 TAAAGCCAGAAGTTATAATTTGG - Intergenic
1112133104 13:96545757-96545779 TAAAAACAGAGGTTCCAAGTAGG + Intronic
1114830376 14:26134185-26134207 CTAAGCCAGAGCTTCTAAATAGG + Intergenic
1120020881 14:79528081-79528103 TTAACCAAAAGGTTCCATTTTGG + Intronic
1121821118 14:96966997-96967019 TCAATCCAGAGACTCCAATTGGG + Intergenic
1124953314 15:34343082-34343104 ATAAGCCAGCGGTCCCAATTCGG + Exonic
1128897927 15:71392867-71392889 TTCAGCCTGAGGTTTCAATTAGG + Intronic
1130065870 15:80604594-80604616 TTAAGCAAGAGGTCCCAGTTGGG + Intergenic
1131907845 15:97163652-97163674 TGAAGCTAGAGGGTCCATTTGGG - Intergenic
1135530425 16:23248424-23248446 TTAAACCAGAGGTTGCAAACGGG + Intergenic
1137691293 16:50429940-50429962 CTAAGCCAGATGGTCCAACTTGG - Intergenic
1138039604 16:53648744-53648766 TTATGCAAGACGTTACAATTAGG + Intronic
1140847034 16:78900531-78900553 TCTAAGCAGAGGTTCCAATTTGG + Intronic
1141856977 16:86689500-86689522 TTAAACCAAACGATCCAATTAGG + Intergenic
1142775074 17:2131062-2131084 ATAAGCCAGAGCTTATAATTTGG - Intronic
1144302884 17:13939242-13939264 ATAAGGCAGAGGGTCTAATTGGG + Intergenic
1144441261 17:15284520-15284542 TTATGCCAGAGATTGTAATTAGG - Intergenic
1145857560 17:28176561-28176583 ATAAGCCAGATGTTAAAATTAGG + Intronic
1149024818 17:52015529-52015551 TTAAGCCTTAGTTTTCAATTTGG - Intronic
1151807284 17:76413938-76413960 CTAAGCCCGAGTTTCCAGTTTGG + Intronic
1152106627 17:78333321-78333343 TTAGGCCAGAGGTGCAAATAGGG + Intergenic
1153172695 18:2334088-2334110 TTACCCCTGAGGTTCAAATTTGG - Intergenic
1158724433 18:59956689-59956711 TTATGCCTGATGTTCAAATTAGG + Intergenic
1159266334 18:66084671-66084693 TTAAGCCAGAGATTCCTGTGGGG - Intergenic
927866846 2:26594356-26594378 TTAAGCCAGAGGGACCTATGAGG - Intronic
929167591 2:38898959-38898981 TTAAGCCAAAATTTACAATTTGG + Intronic
930813852 2:55571395-55571417 TTAAGACAGATTTTCCTATTTGG - Intronic
931179330 2:59884061-59884083 ATAAGCCATAGCTTCCAAATTGG + Intergenic
932533829 2:72569633-72569655 TTAAACCAGAGGTTGCAGATTGG - Intronic
936491510 2:112976710-112976732 TTAAGCCTGAATTTCCAACTGGG - Intronic
937106870 2:119323955-119323977 CTAAGCCAGAGGTTTCAAATTGG - Intronic
940029284 2:149243818-149243840 TTAAGACAGTGGTCCTAATTTGG + Intergenic
943726030 2:191252697-191252719 CTAAGCAAGAGGTTACAACTTGG - Intronic
945011689 2:205470655-205470677 CTAAGCCAGAGGATCTAAGTGGG - Intronic
945138057 2:206651265-206651287 TTATGCAAGATGTTCCCATTGGG - Intergenic
945727213 2:213485919-213485941 TTAAGAAAGAGGTACCCATTGGG + Intronic
948184401 2:236008624-236008646 TAAAACCAGAAGTTCCAATTAGG - Intronic
1172178107 20:32984801-32984823 CTGAGCAAGAGGTTCCCATTGGG - Intronic
1176380442 21:6110157-6110179 TTAAGCCTGAGGACCCATTTGGG - Intergenic
1176925281 21:14741557-14741579 CTAAGCCAGAGATTTTAATTAGG - Intergenic
1179272300 21:39860948-39860970 ATAAGCCAGAGCTTCCAAAATGG + Intergenic
1179743030 21:43428083-43428105 TTAAGCCTGAGGACCCATTTGGG + Intergenic
950693819 3:14682570-14682592 TTGAGCCAGTGGTTCCTATCCGG - Exonic
954008435 3:47612807-47612829 TTAAACCAAAAGTTCCAATGTGG + Intronic
956517076 3:70061331-70061353 CTAAGCCAGAGGTCCTAAATTGG + Intergenic
963929021 3:150982725-150982747 GTGAGCCAAAGGTTCCTATTGGG - Intergenic
965712882 3:171573761-171573783 TTAAACCAGTGTTTCCAAGTAGG - Intergenic
966423193 3:179754479-179754501 TTAAGCCTGAGGTTACAAATTGG - Intronic
970525227 4:16925329-16925351 TTAAGCCAGAAATTATAATTTGG + Intergenic
970615002 4:17760746-17760768 GTAAGCCAGAGTTTCCAAGGAGG - Intronic
970782218 4:19751493-19751515 TTAATCCAGTGGTTCCCAATGGG + Intergenic
971906662 4:32734956-32734978 TGAAGCCACATGTTCAAATTGGG - Intergenic
973099031 4:46239267-46239289 TTTATTCAGAGGTTACAATTAGG - Intergenic
977961922 4:103096251-103096273 TTAAACCACAGGTTCCATTATGG - Exonic
980880937 4:138709309-138709331 TCAAAACAGAGCTTCCAATTTGG - Intergenic
984046779 4:174810414-174810436 TTAAGAAAAATGTTCCAATTAGG - Intronic
985497334 5:216806-216828 TTAGGCCGGATATTCCAATTTGG + Exonic
985682385 5:1263233-1263255 TTAAACCAGAGGTTTAAACTGGG - Intronic
985738246 5:1598150-1598172 TTAGGCCGGATATTCCAATTTGG - Intergenic
990177692 5:53126272-53126294 TGAAGCCAGATCTTCCCATTTGG + Intergenic
999819952 5:155216916-155216938 TGAAGTCAGTGGCTCCAATTAGG + Intergenic
1002915937 6:1527708-1527730 TTAAGCTAGAAGTTCCCCTTGGG + Intergenic
1004036715 6:11931554-11931576 TTAAGCCAGTGCTTCCAAAGAGG + Intergenic
1004280811 6:14278165-14278187 TTAACCCAGAGGTTGCAGTCGGG + Intergenic
1006465307 6:34190454-34190476 TTAACCCAGAGCTGGCAATTAGG - Intergenic
1006885143 6:37375473-37375495 TCAAGTCAGAGGTTGCAAATTGG - Intronic
1010908068 6:81517993-81518015 TTAGGCCAGAGGATCCTTTTAGG + Intronic
1011712704 6:90070690-90070712 TGAAGCCACAGGTTCCACTGTGG + Intronic
1011854138 6:91667637-91667659 GTAAGCCAGAAGTTCCAAACTGG - Intergenic
1013872870 6:114788423-114788445 TTAACCCAGAGATTCCAATAAGG - Intergenic
1014736238 6:125098877-125098899 TGAAGCCAGGGATTCCAACTGGG + Intergenic
1014989846 6:128061078-128061100 TTAAATCAGAGCTTCAAATTTGG + Intronic
1016105324 6:140155446-140155468 TTAAGCAAGAGATTCTTATTTGG - Intergenic
1018268362 6:162050633-162050655 CCAAGCCTGAGGTTCCAATAAGG + Intronic
1020821151 7:12969542-12969564 TCAATCCAGTGGTTCTAATTTGG - Intergenic
1023682775 7:42704724-42704746 TGAAGTCAGTGGTACCAATTTGG - Intergenic
1024246750 7:47476554-47476576 AAAAGCCAGAGGTCCCAATGAGG + Intronic
1028109915 7:86927690-86927712 TTAAACCAGAGATACCAAATGGG + Intronic
1038106698 8:24443191-24443213 TTAAGCCTTAGGTTTTAATTGGG + Intronic
1042099114 8:65255118-65255140 TTAAGCTAGAGGTTAATATTTGG - Intergenic
1042254760 8:66791405-66791427 CTGAGCCAAAGGTTCCAGTTTGG - Intronic
1042861611 8:73319726-73319748 TGAGGCCAGAGGTTCACATTCGG + Intronic
1044525557 8:93247018-93247040 TAAAGCCAGATGACCCAATTTGG - Intergenic
1046765065 8:118060251-118060273 TTAAGCCAGTGGTCACAAATTGG + Intronic
1048747530 8:137631576-137631598 CTAAGACAGGAGTTCCAATTTGG - Intergenic
1050086252 9:1968842-1968864 TTTTGCCAGAGGTTCCAGCTGGG - Intergenic
1050944369 9:11499151-11499173 TTAAGCCTGAGGTTTCTAATGGG - Intergenic
1050970876 9:11871811-11871833 TTAAGGGAAAGGTTGCAATTTGG + Intergenic
1051253725 9:15190027-15190049 TAAAACCAGAAATTCCAATTAGG - Intronic
1051311625 9:15780218-15780240 TTAAGCCATAGGTTTCTTTTCGG + Intronic
1053294459 9:36902924-36902946 TGAAGCCAGAGGCTGCACTTAGG - Intronic
1056219787 9:84439801-84439823 TTTATCCAGACGTTCCATTTAGG - Intergenic
1056327387 9:85491068-85491090 ATAAGGCAGAGGGTCTAATTGGG + Intergenic
1057711857 9:97452841-97452863 TTAAGACAGCAGTTCCTATTTGG + Intronic
1058650609 9:107172391-107172413 TTAACCCTGAGGTTCTGATTTGG + Intergenic
1060888554 9:127173591-127173613 TTCACCCAGAAGTTCCTATTCGG + Intronic
1186080223 X:5923093-5923115 TTAAGCCATATGTCCCCATTGGG + Intronic
1188051168 X:25488649-25488671 TTAGCTCAGAGGCTCCAATTCGG - Intergenic
1190070483 X:47275198-47275220 TTATGCCAGATGTTACCATTTGG - Intergenic
1192287916 X:69758264-69758286 ATAAGCCAAAAGTTCCAGTTGGG + Intronic
1192743111 X:73912552-73912574 GAAAGCCAGAGGTTCTAAATGGG - Intergenic
1195653119 X:107307719-107307741 TTATACCAGAGGTTCTAATCAGG + Intergenic
1195934668 X:110113451-110113473 TTAAACCTGATGATCCAATTAGG + Intronic
1199531911 X:148858035-148858057 TTATACCACAGGTTCAAATTTGG - Intronic
1199542811 X:148976265-148976287 TTAAGCAAGATGTTCCCATTGGG - Intronic
1201418020 Y:13767462-13767484 TTAAGGCAGAGGTTCTTAATTGG + Intergenic
1202273916 Y:23096427-23096449 TGAAGCCAGAGGTTACAGTGAGG + Intergenic
1202292110 Y:23324250-23324272 TGAAGCCAGAGGTTACAGTGAGG - Intergenic
1202426912 Y:24730172-24730194 TGAAGCCAGAGGTTACAGTGAGG + Intergenic
1202443879 Y:24939922-24939944 TGAAGCCAGAGGTTACAGTGAGG - Intergenic