ID: 1098886385

View in Genome Browser
Species Human (GRCh38)
Location 12:75964791-75964813
Sequence CATGATTACTCTTAAGCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 293
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 274}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098886385_1098886389 21 Left 1098886385 12:75964791-75964813 CCTCTGGCTTAAGAGTAATCATG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 1098886389 12:75964835-75964857 GGGAGATCAGGTCTATACGCTGG 0: 1
1: 0
2: 0
3: 1
4: 41
1098886385_1098886386 0 Left 1098886385 12:75964791-75964813 CCTCTGGCTTAAGAGTAATCATG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 1098886386 12:75964814-75964836 TTTCTTCAGTATTAGTGAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 153
1098886385_1098886387 1 Left 1098886385 12:75964791-75964813 CCTCTGGCTTAAGAGTAATCATG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 1098886387 12:75964815-75964837 TTCTTCAGTATTAGTGAGCAGGG 0: 1
1: 0
2: 1
3: 14
4: 186
1098886385_1098886388 9 Left 1098886385 12:75964791-75964813 CCTCTGGCTTAAGAGTAATCATG 0: 1
1: 0
2: 1
3: 17
4: 274
Right 1098886388 12:75964823-75964845 TATTAGTGAGCAGGGAGATCAGG 0: 1
1: 0
2: 2
3: 9
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098886385 Original CRISPR CATGATTACTCTTAAGCCAG AGG (reversed) Intergenic
902899206 1:19502506-19502528 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
902927716 1:19707787-19707809 CATGCTTCCTGTTAAGCCTGTGG - Intronic
904375047 1:30075591-30075613 CATGTTTCCTGTTAAGCCTGTGG + Intergenic
905320858 1:37116158-37116180 CATGCTTTCTGTTAAGCCTGTGG - Intergenic
906465944 1:46079506-46079528 CTTTCTTTCTCTTAAGCCAGTGG - Intronic
907390609 1:54155796-54155818 CATGCTTCCTGTTAAGCCTGTGG - Intronic
909120969 1:71602554-71602576 CATGATTATTCTTAACCCCGTGG + Intronic
910355218 1:86345224-86345246 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
910616464 1:89204236-89204258 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
911646363 1:100341465-100341487 CATTATTCCTGTTAAGCCTGTGG - Intergenic
911701160 1:100953185-100953207 CATGCTTCCTGTTAAGCCTGTGG + Intronic
914840298 1:151242740-151242762 CATGAGAAATCTTGAGCCAGAGG - Intronic
918220778 1:182434459-182434481 CATGACCACACTTAAGCCAGAGG + Intergenic
918581541 1:186136675-186136697 TATTATCACTCTTGAGCCAGTGG + Exonic
920843682 1:209575970-209575992 CATGCTCACCCATAAGCCAGAGG - Intergenic
921640599 1:217548039-217548061 CATGTTTCCTGTTAAGCCTGTGG + Intronic
923540577 1:234885594-234885616 CATGATCACCCTTGGGCCAGGGG - Intergenic
924222331 1:241890866-241890888 CCAGATTCCTCTAAAGCCAGAGG + Intronic
1063793318 10:9480653-9480675 CATGAATATTATTAAGACAGCGG + Intergenic
1065728801 10:28691873-28691895 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1065947567 10:30620317-30620339 CATGGTTACTCATAAGCGGGTGG - Intronic
1067995035 10:51262661-51262683 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1068230347 10:54163308-54163330 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1069377642 10:67810059-67810081 CATGCTTTCTGTTAAGCCTGAGG - Intronic
1069507386 10:69012939-69012961 CATGCTTCCTGTTAAGCCTGAGG - Intronic
1073473438 10:103738096-103738118 CATCTTTTCTCTGAAGCCAGAGG + Intronic
1074007203 10:109439481-109439503 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1074714109 10:116202563-116202585 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1075100583 10:119503474-119503496 CACGATTTCTCTTCAGCCACTGG - Intronic
1075167252 10:120079856-120079878 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1075656786 10:124167198-124167220 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1075691869 10:124401788-124401810 CATGCTGACCATTAAGCCAGGGG - Exonic
1075812824 10:125238402-125238424 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1078393551 11:10957157-10957179 CATGCTTCCTGTTAAGCCAGTGG + Intergenic
1078518661 11:12046498-12046520 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1078622877 11:12925250-12925272 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1078674204 11:13394458-13394480 CATGCTTCCTGTTAAGCCTGCGG + Intronic
1079567864 11:21904668-21904690 CATCATTACCCTCAAGCTAGGGG + Intergenic
1079818620 11:25094929-25094951 CATGATTTCTGTTAAGCCAGTGG - Intergenic
1080702528 11:34656337-34656359 GAAGATGACTTTTAAGCCAGAGG - Intronic
1081068396 11:38577244-38577266 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1084617656 11:70247149-70247171 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1086965945 11:93028312-93028334 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1087906940 11:103709434-103709456 CATGTTTTCTGTTAAGCCTGTGG - Intergenic
1088506881 11:110535597-110535619 CATGCTTTCTGTAAAGCCAGTGG - Intergenic
1090653823 11:128827394-128827416 CATGATTTCTGCTAAGCAAGAGG - Intergenic
1091017129 11:132062017-132062039 CATGGTAACTCCTCAGCCAGTGG - Intronic
1094771889 12:33671988-33672010 CATGAGTAAACTTGAGCCAGAGG + Intergenic
1095194827 12:39301553-39301575 CATGGATACTTTTATGCCAGTGG - Exonic
1098155223 12:67590540-67590562 CATGCTTACTTTTAAGCCTAAGG - Intergenic
1098886385 12:75964791-75964813 CATGATTACTCTTAAGCCAGAGG - Intergenic
1099547600 12:84004971-84004993 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1102335333 12:112073893-112073915 CTGGAGTACTCTTAAGCCACTGG + Intronic
1103673045 12:122633860-122633882 CATGCTTCCTGTTAAGCCTGCGG + Intergenic
1107111701 13:36704866-36704888 CATTATCACTCATAAGCCACAGG - Intergenic
1107329543 13:39284164-39284186 CAAGATACCTCTGAAGCCAGGGG - Intergenic
1108832696 13:54499207-54499229 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1109162137 13:58988718-58988740 GATGCTTCCTCTTAAGCCTGTGG + Intergenic
1109547435 13:63846858-63846880 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1110511896 13:76360758-76360780 CATCTTGATTCTTAAGCCAGAGG - Intergenic
1110613767 13:77518819-77518841 CAGGTTTACTCCTAAGCCTGCGG + Intergenic
1111360169 13:87165760-87165782 CATGCTTCCTAATAAGCCAGTGG + Intergenic
1111578514 13:90191070-90191092 CATGATTCCTGTTAAGCCTGTGG - Intergenic
1112881219 13:104108510-104108532 CATGCTTTCTGTTAAGCCTGTGG + Intergenic
1112881446 13:104110455-104110477 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1112944673 13:104913459-104913481 CAGGTTTCCTCTTAAGACAGTGG - Intergenic
1113497137 13:110739786-110739808 CATGCTTTCTGTTAAGCCTGTGG + Intergenic
1113527041 13:110987945-110987967 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1114330190 14:21629055-21629077 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1115077472 14:29408939-29408961 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1115199919 14:30842006-30842028 CCTAATTACTCTTCAGCTAGAGG + Intergenic
1116745030 14:48806938-48806960 CATGAATATTCTTACTCCAGGGG + Intergenic
1117650133 14:57895704-57895726 CATGCTTTCTGTTAAGCCTGTGG + Intronic
1118396303 14:65340043-65340065 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1118964054 14:70562782-70562804 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1120099825 14:80431820-80431842 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1120101706 14:80451749-80451771 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1121237783 14:92405565-92405587 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1121860749 14:97315812-97315834 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1124693932 15:31847769-31847791 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1124953313 15:34343071-34343093 CATGATCGCTTATAAGCCAGCGG + Exonic
1125228115 15:37419267-37419289 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1125303487 15:38283099-38283121 CATGCTTTCTGTTAAGCCTGTGG - Intronic
1126937232 15:53724443-53724465 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1131788587 15:95939628-95939650 AATCATTACTCTTAGGCCTGTGG + Intergenic
1133593266 16:7266432-7266454 CATGTTTGCTATAAAGCCAGTGG + Intronic
1135729164 16:24880201-24880223 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1137921217 16:52490308-52490330 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1138315586 16:56067042-56067064 CAGGATTCCTCTTTAGCCATCGG - Intergenic
1138804454 16:60077984-60078006 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1138842805 16:60529323-60529345 CATGCTTCCTATTAAGCCTGCGG + Intergenic
1140151162 16:72367916-72367938 CATGATTTCTCTCTAGCCAGGGG + Intergenic
1140290294 16:73647550-73647572 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1146078663 17:29757051-29757073 CATGAGTACACTTAGCCCAGTGG - Intronic
1149445836 17:56712610-56712632 CATGCTTCCTGTTAAGCCGGTGG + Intergenic
1151542883 17:74773807-74773829 TATGATTGCTCCTAAGGCAGGGG + Intronic
1153506500 18:5804467-5804489 CATGTTTCCTGTTAAGCCTGTGG + Intergenic
1154100646 18:11469972-11469994 CATGCTTCCTCTTAAGCTTGAGG - Intergenic
1155338347 18:24788197-24788219 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1157891367 18:51421327-51421349 CATGCTTCCTATTAAGCCTGTGG - Intergenic
1158158513 18:54453135-54453157 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1158918616 18:62164396-62164418 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1161762348 19:6183349-6183371 CAGGATTCCTCTTAACCCAGAGG - Intronic
1164573198 19:29388748-29388770 CATTAGTTCTCTTAAGACAGTGG - Intergenic
925847992 2:8051081-8051103 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
926469354 2:13234295-13234317 CATGCCCACTCTGAAGCCAGGGG + Intergenic
926646729 2:15297625-15297647 CATGCTTCCTGTTAAGCCTGTGG + Intronic
928464845 2:31514151-31514173 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
929100947 2:38312788-38312810 CATGCTTCCTGTTAAGCCTGTGG + Intronic
930452551 2:51560493-51560515 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
930536230 2:52649221-52649243 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
930961349 2:57266133-57266155 CATGATTCCTTTTAAGCCTGTGG - Intergenic
930961576 2:57268044-57268066 CATGATTTCTTTTAAGCCTATGG - Intergenic
931921074 2:67016495-67016517 CATGTTTTCTGTTAAGCCTGTGG - Intergenic
933683977 2:85128399-85128421 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
935026904 2:99285632-99285654 TATGATTATTCATAAGACAGAGG - Intronic
936730428 2:115375688-115375710 CATGATTTGTGTTAAGCCTGTGG - Intronic
937955033 2:127417325-127417347 CATGTTTACGCTTAAAGCAGAGG - Intergenic
939727441 2:145740470-145740492 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
940499786 2:154479064-154479086 CATGCTTCCTATTAAGCCTGTGG + Intergenic
942139405 2:172962975-172962997 CATGCTTCCTGTTAAGCCTGTGG - Intronic
943183472 2:184574920-184574942 CATGCTTCCTATTAAGCCTGTGG - Intergenic
943395698 2:187329768-187329790 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
943737433 2:191372253-191372275 GATTATTGATCTTAAGCCAGTGG + Intronic
944470159 2:200044877-200044899 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
944621560 2:201521319-201521341 CATGCTTCCTGTTAAGCCTGTGG - Intronic
946316934 2:218922543-218922565 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
948170522 2:235898148-235898170 CAGGACTACTCTGAAGCTAGTGG - Intronic
1168923837 20:1563631-1563653 CATGCTTCCTGTTAAGCCTGTGG - Exonic
1170388481 20:15846711-15846733 CATGTTTTCTCTCTAGCCAGTGG - Intronic
1171085970 20:22238799-22238821 AATAATGCCTCTTAAGCCAGGGG - Intergenic
1171312250 20:24153953-24153975 CATGTTTTCTCATAAGCCACTGG + Intergenic
1172314033 20:33939731-33939753 CATGCTTTCTGTTAAGCCTGTGG + Intergenic
1173411676 20:42816738-42816760 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1173432538 20:43002200-43002222 CATGCTTTCTGTTAAGCCTGTGG + Intronic
1174916066 20:54655149-54655171 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1177247055 21:18540388-18540410 CATGGTTACTATTAAGGAAGGGG - Intergenic
1177393405 21:20504403-20504425 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1178974028 21:37206785-37206807 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1179439685 21:41384188-41384210 CATGCTTCCTGTTAAGCCCGTGG + Intronic
1179952388 21:44716196-44716218 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1181836730 22:25616275-25616297 CATGCTTCCTCTTAGGCCTGTGG - Intronic
1184357001 22:43988644-43988666 CATGATTAATCAAAAGGCAGAGG - Intronic
950514888 3:13458496-13458518 CATGTTTACTCCCAAGCCTGTGG - Intergenic
951457073 3:22904552-22904574 CATGCTTCCTATTAAGCCTGTGG + Intergenic
955136780 3:56226897-56226919 CATGATTACTCCAAAGACATTGG + Intronic
956572339 3:70711367-70711389 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
956572664 3:70713687-70713709 CATGTTTCCTGTTAAGCCTGTGG - Intergenic
957312675 3:78540691-78540713 CATGATTATTCATAAGCGGGTGG - Intergenic
957495257 3:80983359-80983381 CATGCTTTCTGTTAAGCCTGTGG + Intergenic
958410495 3:93809723-93809745 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
959382203 3:105654447-105654469 CATGATGACTCTTAGGACACAGG + Intergenic
959508330 3:107179141-107179163 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
960591913 3:119374759-119374781 CATGCTTTCTGTTAAGCCTGTGG + Intronic
960815363 3:121666314-121666336 GATGATGACTCTTGAGCCTGTGG - Intronic
961771349 3:129252426-129252448 CATGATCACTCTTAGGCTATTGG + Intronic
962859222 3:139382382-139382404 CATGCTTCCTGTTAAGCCTGTGG + Intronic
963300642 3:143593454-143593476 AATGAATACACTTAATCCAGAGG - Intronic
963312541 3:143724348-143724370 CATGCTTCCTGTTAAGCCTGCGG + Intronic
963360158 3:144261878-144261900 CAAGATTTCTCTTAAGACATTGG + Intergenic
963416577 3:145002580-145002602 CATGATTCCTGTAAAGCCTGTGG - Intergenic
964013197 3:151915337-151915359 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
964060764 3:152519415-152519437 CAAGATTACTTTTAACCCAGAGG - Intergenic
964482682 3:157158591-157158613 CTTGTTTAATCTTAAGCCACAGG + Intronic
965730927 3:171771614-171771636 AATGATTAATTTTAAGCAAGGGG + Intronic
967097441 3:186188513-186188535 CATGATTTCTCTTCTGACAGTGG - Intronic
968965905 4:3769012-3769034 CACCATCACTCTTAGGCCAGAGG + Intergenic
969684233 4:8660812-8660834 CATGTTTCCTGTTAAGCCTGCGG + Intergenic
970086005 4:12347135-12347157 CATGCTTTCTGTTAAGCCTGTGG - Intergenic
970567111 4:17342168-17342190 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
970832217 4:20353965-20353987 CATGATTACTTTTAAGTTATGGG - Intronic
971294766 4:25378282-25378304 CCAGATAACTCTCAAGCCAGAGG - Intronic
971506704 4:27374181-27374203 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
972758932 4:42082263-42082285 CATAATTAATCTTAAGTCAAAGG + Intronic
972844524 4:42971452-42971474 CATGCTTCCTGTTAAGCCTGTGG - Intronic
972914977 4:43865607-43865629 CATGGTCACCCTTAAGCCAGAGG - Intergenic
973874457 4:55202376-55202398 CATGATTTCTCTTAGGCCATTGG + Intergenic
974556829 4:63461556-63461578 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
974600348 4:64071523-64071545 CATGCTTCCTGTTAAGCCAGTGG + Intergenic
974821634 4:67074012-67074034 CATGACTCCTCTTAAAACAGTGG - Intergenic
976287687 4:83386048-83386070 CATGCTTCCTGTTAAGCCTGCGG - Intergenic
977242894 4:94594964-94594986 CATGATTCCTGTTAAGCCTGTGG - Intronic
977254565 4:94726596-94726618 CCTGGTTACCCTTAAGCCACAGG + Intergenic
977528128 4:98168585-98168607 CAGGAATATTCTTTAGCCAGAGG - Intergenic
977597905 4:98903902-98903924 CATCATTAATTTTAAGCTAGTGG - Intronic
978086173 4:104657822-104657844 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
979459150 4:120960871-120960893 CATGATTATTCATAAGGAAGTGG + Intergenic
979814174 4:125078842-125078864 CAGGATTTCTCTGAAGGCAGTGG - Intergenic
980080752 4:128341391-128341413 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
982421408 4:155202875-155202897 CATGTTTCCTCTTTAGCCATGGG + Intergenic
984070103 4:175100533-175100555 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
985481644 5:115120-115142 CAAAATTACTCTTGAGCCATAGG + Intergenic
985867115 5:2522652-2522674 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
987162879 5:15163085-15163107 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
987532465 5:19140448-19140470 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
988355200 5:30164025-30164047 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
989648278 5:43660623-43660645 CATGCTTCCTGTTAAGCCTGTGG - Intronic
990874337 5:60467713-60467735 CATGCTTCCTGTTAAGCCTGGGG - Intronic
991042508 5:62190463-62190485 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
993415616 5:87626129-87626151 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
994019967 5:95011697-95011719 CATGCTTCCTGTTAAGCCTGTGG + Intronic
994296508 5:98095413-98095435 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
994943534 5:106356348-106356370 CATGCTTTCTGTTAAGCCTGAGG - Intergenic
995170966 5:109111631-109111653 CATGCTTCCTGTTAAGCCTGTGG - Intronic
995304583 5:110630655-110630677 CATGCTTCCTGTTAAGCCTGTGG + Intronic
996521798 5:124435857-124435879 CATGCTTCCCATTAAGCCAGTGG + Intergenic
997086767 5:130809147-130809169 CATGATTATTCATAAGGAAGTGG - Intergenic
1003214999 6:4100959-4100981 CATGCTTCCTGTTAAGCCCGTGG + Intronic
1003484255 6:6562330-6562352 CATGCTTTCTGTTAAGCCTGTGG - Intergenic
1003762917 6:9201488-9201510 GATGATAACTCTTAAGCCTTTGG + Intergenic
1004011590 6:11693353-11693375 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1004233169 6:13851008-13851030 CATGTTTCCTGTTAAGCCTGTGG + Intergenic
1004473694 6:15951502-15951524 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1004701681 6:18085459-18085481 CATGAGAGATCTTAAGCCAGAGG + Intergenic
1010046840 6:71454331-71454353 CATGCTTCCTGTTAAGCCTGAGG + Intergenic
1011287823 6:85743851-85743873 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1013626356 6:111941006-111941028 CATGATTTCTCTAAGGACAGGGG - Intergenic
1013642796 6:112103250-112103272 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1013715964 6:112961850-112961872 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1013754037 6:113440256-113440278 CATGAGTAATTTTAAGCAAGAGG + Intergenic
1014365142 6:120530945-120530967 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1016255423 6:142099330-142099352 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1016646794 6:146419616-146419638 CGTGATTCCTGTTAAGCCTGTGG - Intronic
1017790933 6:157798995-157799017 CATGGTTTCTCTTAAGCCTGTGG - Intronic
1018110117 6:160528332-160528354 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1018592450 6:165442417-165442439 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1020630439 7:10632925-10632947 CATGAGAAATCTTGAGCCAGAGG - Intergenic
1021482860 7:21136890-21136912 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1022979203 7:35588264-35588286 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1023388943 7:39688855-39688877 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1024163023 7:46698596-46698618 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1026272470 7:68848524-68848546 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1030072524 7:105710267-105710289 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1031315772 7:120256135-120256157 CATGCTTACTGTTAAGCCTGTGG + Intergenic
1032380496 7:131474846-131474868 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1034824961 7:154253823-154253845 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1036036744 8:5028351-5028373 CATGATTATTCTTAAGAGGGTGG + Intergenic
1036693622 8:10960417-10960439 CATGCTTACTCTGAAGGCCGGGG + Intronic
1038119494 8:24596898-24596920 CATGCTTCCTGTTAAGCCTGAGG - Intergenic
1041940356 8:63380913-63380935 CATGCTTTCTATTAAGCCTGTGG + Intergenic
1041991392 8:63996251-63996273 CAGGATTACTCTCTAACCAGCGG + Intergenic
1043144826 8:76639744-76639766 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1043184365 8:77127163-77127185 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1043187494 8:77173087-77173109 CATGCTTCCTATTAAGCCTGTGG - Intergenic
1043205090 8:77427360-77427382 CATAATTCCTGTTAAGCCTGTGG + Intergenic
1043216346 8:77594352-77594374 CATGATTAATCTTAACCAGGGGG - Intergenic
1044294970 8:90517504-90517526 CATGCTTACTGTTAAGCCTGTGG + Intergenic
1044863521 8:96546567-96546589 CATTATTAATAATAAGCCAGGGG + Intronic
1045315708 8:101041804-101041826 CATGAATCCTATTGAGCCAGTGG - Intergenic
1045336995 8:101214355-101214377 CATCATTACTCTTGAGCAGGGGG + Intergenic
1045688785 8:104738983-104739005 CATGGGTAGACTTAAGCCAGAGG - Intronic
1046339145 8:112828567-112828589 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1046359340 8:113130528-113130550 CATGCTTCCTATTAAGCCTGTGG + Intronic
1047107961 8:121755629-121755651 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1048462145 8:134629743-134629765 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1048526394 8:135206698-135206720 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1050839638 9:10132127-10132149 AATGATTATTCTTAAGACATTGG + Intronic
1051811446 9:21054180-21054202 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1053339705 9:37313817-37313839 CATGCTTCCTGTTAAGCCTGTGG + Intronic
1053546920 9:39032767-39032789 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1053811239 9:41854420-41854442 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1054619355 9:67333019-67333041 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1055223728 9:73969057-73969079 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1055647078 9:78371456-78371478 AATAACTACTCTTAACCCAGAGG - Intergenic
1055916361 9:81404651-81404673 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1056604232 9:88072745-88072767 CATGCTTCCTCTAAAGCCTGTGG - Intergenic
1058397727 9:104574224-104574246 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1059444043 9:114327325-114327347 CATGCTTCCTCTGAAGCCTGCGG + Intergenic
1059445250 9:114334104-114334126 CATGCTTCCTCTGAAGCCTGCGG + Intergenic
1060307830 9:122432539-122432561 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1185916540 X:4041631-4041653 CATGATTACTGTACAGCCTGTGG + Intergenic
1185932815 X:4221724-4221746 CATGCTTTCTGTTAAGCCTGTGG + Intergenic
1186695727 X:12029864-12029886 CATGTTTACACTTAAGGGAGGGG + Intergenic
1187052633 X:15709712-15709734 CATCCTGACTCTTAAACCAGAGG - Intronic
1187060115 X:15778652-15778674 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1187947980 X:24444996-24445018 CATCAATACTCTTAAGACTGTGG - Intergenic
1188500668 X:30822380-30822402 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1188800908 X:34528257-34528279 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1190138415 X:47818135-47818157 CATGATTATTCTTAAGAGGGTGG + Intergenic
1190535507 X:51422381-51422403 CATGATTATTCATAAGGAAGTGG - Intergenic
1191090013 X:56609823-56609845 CATGCTTCCTGTTAAGCCTGTGG - Intergenic
1194898412 X:99474201-99474223 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1194903296 X:99542093-99542115 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1194903533 X:99544016-99544038 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1195403859 X:104491617-104491639 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1196059423 X:111391336-111391358 CATGCTTCCTATTAAGCCTGTGG + Intronic
1196309828 X:114150664-114150686 CATGCTTCCTGTTAAGCCTGTGG + Intergenic
1197844783 X:130789982-130790004 CAATATTACTCTTCAGCCACAGG + Intronic
1198055104 X:132986090-132986112 CATGATTCCTGTTCAGCCTGTGG + Intergenic
1198228946 X:134671491-134671513 CATGCTTCCTGTTAAGCCTGTGG - Intronic
1198331184 X:135624529-135624551 CATGATTATTCTTAAGGAAGTGG + Intergenic
1198335158 X:135658595-135658617 CATGATTATTCTTAAGGAAGTGG - Intergenic
1199222851 X:145337612-145337634 CATTTTTACTCTAAAGCCATTGG + Intergenic