ID: 1098897487

View in Genome Browser
Species Human (GRCh38)
Location 12:76080789-76080811
Sequence GTGGCAGCACTGAGAGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 338}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098897479_1098897487 11 Left 1098897479 12:76080755-76080777 CCTCTAAAACTCAAGTTGAAATT 0: 6
1: 55
2: 437
3: 1438
4: 3277
Right 1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG 0: 1
1: 0
2: 4
3: 24
4: 338
1098897477_1098897487 13 Left 1098897477 12:76080753-76080775 CCCCTCTAAAACTCAAGTTGAAA 0: 3
1: 54
2: 497
3: 2029
4: 2785
Right 1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG 0: 1
1: 0
2: 4
3: 24
4: 338
1098897478_1098897487 12 Left 1098897478 12:76080754-76080776 CCCTCTAAAACTCAAGTTGAAAT 0: 5
1: 41
2: 461
3: 2280
4: 3869
Right 1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG 0: 1
1: 0
2: 4
3: 24
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098897487 Original CRISPR GTGGCAGCACTGAGAGATGG GGG Intronic
900993166 1:6107106-6107128 GTGGAAGGACGGAGGGATGGAGG + Intronic
900993357 1:6107886-6107908 GTGGAAGGATGGAGAGATGGAGG + Intronic
900995590 1:6121641-6121663 GTGGCAGAGAGGAGAGATGGGGG + Intronic
901349693 1:8583074-8583096 GTGGCAGCCATGAGAGATAATGG + Intronic
901455532 1:9360895-9360917 GTGGCAGCACAGGGAGAGGAAGG - Intronic
902116234 1:14123930-14123952 TTGTCATCACTGAGAGATGAAGG - Intergenic
902492059 1:16790084-16790106 GAGGCATCCCTGAGAGAGGGAGG - Intronic
902515950 1:16989771-16989793 CTGGGAGCACAGGGAGATGGGGG + Intronic
903046259 1:20566378-20566400 GAGGCAGCAGACAGAGATGGTGG - Intergenic
903879796 1:26500868-26500890 GTGGCAGCGCTCAGGGAAGGAGG - Intergenic
905766058 1:40602123-40602145 GTGGCAGCAGAGAGCAATGGAGG - Intergenic
906069165 1:43005208-43005230 GTAGTGGCACAGAGAGATGGAGG + Intergenic
907624020 1:56010800-56010822 GTGCCACCACAGAGAGATGCAGG - Intergenic
909012298 1:70348360-70348382 GAGGCAGGACTGGGAGGTGGAGG - Intronic
910260679 1:85290818-85290840 GTGGCAGGAGTGAGAGAGCGCGG + Intergenic
910640871 1:89460618-89460640 CTGGCAGCAGCCAGAGATGGAGG + Intergenic
910708508 1:90155006-90155028 GTGACTGCTGTGAGAGATGGGGG + Intergenic
911127569 1:94354497-94354519 ATGGCAGAATGGAGAGATGGCGG + Intergenic
913275994 1:117138196-117138218 ATGGCAGCATGTAGAGATGGCGG - Intergenic
913383413 1:118233611-118233633 GTGGCTGCTATGGGAGATGGGGG - Intergenic
913712751 1:121502358-121502380 GTGGCAGCAATGGAAGCTGGAGG + Intergenic
915276945 1:154795684-154795706 GTGGGGGCACTGAAAGTTGGTGG + Intronic
915362213 1:155293033-155293055 GAGGCAGCAATGACAGCTGGAGG - Intronic
916386372 1:164275818-164275840 GTGGGAGAATAGAGAGATGGTGG + Intergenic
917736094 1:177921585-177921607 CTGGCAGTGCTGAGAGAAGGGGG + Intergenic
918162085 1:181910815-181910837 GTGGCAGGAGAGAGAGAAGGAGG - Intergenic
919053040 1:192534861-192534883 GTGGCAGCTCTGAGAGAATCTGG + Intergenic
920366753 1:205452011-205452033 GAGGCAGCAGGGAGAGATGAGGG + Intronic
920528982 1:206687933-206687955 GTTGCAGCCCTGAGAGTTGATGG + Intronic
920641724 1:207758585-207758607 GTAACAGCATTGAGAGGTGGTGG - Intronic
921125076 1:212170387-212170409 GTGGCAGTACTGAGAGGTTTGGG + Intergenic
923512941 1:234668528-234668550 GTGACAGTATTGAGAGATGAGGG + Intergenic
923528387 1:234792453-234792475 GAGGCATCCCTGAGAGAGGGAGG + Intergenic
924385725 1:243496653-243496675 GTGGCAGCCCGGGGAGATGGTGG - Intronic
924621333 1:245663886-245663908 GTGGCAGCAGTCAAAGCTGGAGG - Intronic
924758704 1:246964927-246964949 GTGGCAGTACTGCAAGATGGGGG + Intronic
1062842800 10:684195-684217 GTGGCAGCACTGATATGTGTGGG - Intronic
1065568303 10:27040506-27040528 GTGGCTACACTGAGAAATGAAGG + Intronic
1066649935 10:37644777-37644799 GTGGCAGTATTGAGAGGTGGGGG + Intergenic
1067032829 10:42890316-42890338 GTGGCAGTATTGAGAGGTGGGGG + Intergenic
1067687673 10:48476895-48476917 GGGGCAGAACTGAGAAGTGGAGG - Intronic
1069635666 10:69923393-69923415 TTAGCAGCACTGAGAAATGAAGG + Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1070807960 10:79281723-79281745 GTGGGAGCACAGGGAGGTGGAGG + Intronic
1072738233 10:97893756-97893778 TTGGCAGGGCTTAGAGATGGTGG - Intronic
1073476349 10:103756448-103756470 GTGGCAGCAGCGGGTGATGGTGG - Intronic
1074211602 10:111340369-111340391 GTGGCAGGAGTGAGAGAGTGAGG + Intergenic
1075789518 10:125073782-125073804 GGGGCAGCACGCAGAGATGCTGG - Intronic
1075850439 10:125581944-125581966 GAGGCAGCAGTGAGAGGAGGAGG + Intronic
1077006405 11:359726-359748 GAGACAGGACAGAGAGATGGGGG + Intergenic
1077109675 11:856560-856582 GGGGCAGCAGTGAGGGAGGGAGG + Intronic
1077307031 11:1873063-1873085 GTGGAGGCAGGGAGAGATGGAGG + Intronic
1078428944 11:11272486-11272508 AAGGCAGCACTGAGCCATGGAGG - Intronic
1078831655 11:14983065-14983087 GAGGCAGTATTGAGAGGTGGGGG - Intronic
1078963230 11:16304310-16304332 GTGGTAGTATTAAGAGATGGTGG + Intronic
1079561523 11:21827430-21827452 GTGGCAGAAGTGAGATATGAAGG + Intergenic
1080187527 11:29507935-29507957 ATGTCAGCAGTCAGAGATGGAGG - Intergenic
1080827066 11:35857358-35857380 GTGACAGTATTAAGAGATGGAGG - Intergenic
1080871923 11:36243853-36243875 TGGGCAGCACTGACAGAAGGTGG - Intergenic
1080922325 11:36721461-36721483 GTGAGAGCAGTGAGAGAAGGGGG - Intergenic
1080932490 11:36826327-36826349 TTGTCAGCAATGAGAGATGGAGG - Intergenic
1081507759 11:43735863-43735885 GTGGCAGGAGAGAGAGATCGAGG + Intronic
1083184151 11:61007840-61007862 GTGGCGGCTCTGCGAGGTGGTGG + Exonic
1083388650 11:62332221-62332243 ATGCCAGCACTGGGAGGTGGGGG + Intergenic
1083784311 11:64935009-64935031 GGTGCAGCACTGAGAGACGGAGG + Exonic
1083851340 11:65369242-65369264 GTGGCTGAACTGAGAGCTGAAGG + Intergenic
1084725473 11:70939016-70939038 GTGGCAGCAGGGACAGAGGGAGG + Intronic
1085709335 11:78814887-78814909 GTGGCTCCAGTGAGAGACGGTGG - Intronic
1085754047 11:79189323-79189345 GTGGGAACACAGAGAGATGGTGG - Intronic
1085833847 11:79931372-79931394 GTGGCAGCATTGGGTGGTGGGGG - Intergenic
1086427881 11:86704712-86704734 GTGGCAGCAAGGAGAGGTGCAGG - Intergenic
1088096301 11:106104805-106104827 ATGACTGCACTAAGAGATGGTGG - Intergenic
1088360231 11:108981622-108981644 ATGGCACCACTGAGATTTGGGGG + Intergenic
1088811472 11:113395477-113395499 GTGGGAGGACTGAGGGTTGGGGG + Intronic
1089167605 11:116489061-116489083 GTGGCAGCACGGGGAGGAGGTGG - Intergenic
1089938842 11:122394422-122394444 GTGCCAGCACTGAGACCCGGGGG + Intergenic
1090172985 11:124621310-124621332 TTGGCAGCACTCAGGGAAGGAGG - Intergenic
1090945492 11:131426080-131426102 GAGGCATCACTGAGGGCTGGGGG + Intronic
1090964301 11:131584868-131584890 GATGCAGCACTGAGAGGGGGAGG - Intronic
1091540502 12:1456795-1456817 GTGGCAGCTCTCAGAGAGGGTGG + Intronic
1092132583 12:6123104-6123126 GGGGCAGGAATGAGAAATGGAGG + Intronic
1092988062 12:13866010-13866032 GGGGTACCACGGAGAGATGGTGG + Exonic
1093534681 12:20209601-20209623 GTGACAGCAGGGAGAAATGGAGG + Intergenic
1093741981 12:22699548-22699570 GTGGCTGTACTTGGAGATGGGGG + Intergenic
1095739569 12:45592573-45592595 GAGGCGGCTGTGAGAGATGGGGG - Intergenic
1096146822 12:49284212-49284234 GTCCCAGAACTGAGAGTTGGCGG + Intergenic
1097181443 12:57174238-57174260 ATGGGAGCACTGAGGCATGGAGG + Intronic
1098500595 12:71187511-71187533 GTGGCTGCTGTGGGAGATGGGGG - Intronic
1098897487 12:76080789-76080811 GTGGCAGCACTGAGAGATGGGGG + Intronic
1101439555 12:104693304-104693326 GTGACACCACTGAAAAATGGAGG + Intronic
1101761138 12:107660070-107660092 GTGGCAGCATTATGGGATGGGGG + Intergenic
1102128958 12:110509855-110509877 GTGGCAGGAGTCAGGGATGGAGG + Intronic
1102461564 12:113102935-113102957 GAGACAGAACTGGGAGATGGGGG - Intronic
1102507673 12:113394008-113394030 TTGGCAACACTGAGAGAAGTGGG + Exonic
1103000835 12:117384311-117384333 ATGTCAGCACTGATGGATGGAGG - Intronic
1103234016 12:119357082-119357104 GTAGCACCATTAAGAGATGGGGG + Intronic
1103916029 12:124376161-124376183 GTGGCTGCTCTGAGAGATCAGGG - Intronic
1104588756 12:130067882-130067904 GTGGCAGAAGTGATAGGTGGGGG - Intergenic
1105706688 13:22971668-22971690 GCGGCAGCACTGAGGGCCGGGGG - Intergenic
1107043459 13:35972647-35972669 GGGGCAGCACTGAGACAGAGTGG + Intronic
1107938530 13:45364885-45364907 GGGAGAGCACTGAGAGATGATGG + Intergenic
1108131901 13:47310557-47310579 GTGGCTGCTATGGGAGATGGGGG - Intergenic
1109267974 13:60222368-60222390 GCAGCAGCTCTCAGAGATGGTGG - Intergenic
1111604668 13:90521481-90521503 TTGGCATCCCTGAAAGATGGGGG + Intergenic
1112157971 13:96838079-96838101 GTGGGATCATTTAGAGATGGGGG + Exonic
1113240254 13:108328946-108328968 GTGGCTGCTCTGGGGGATGGGGG - Intergenic
1115863207 14:37712641-37712663 GTGGCAGCAAGGAGAAATGATGG + Intronic
1116126701 14:40797484-40797506 GTGGCAGCACGGAGAAATGCAGG + Intergenic
1117100474 14:52340899-52340921 GTAGCAGCACAGGGAAATGGAGG - Intergenic
1117163156 14:53008607-53008629 GTGGCAGGAGAGAGAGAAGGGGG - Intergenic
1119429200 14:74554996-74555018 GTAGCTGCTCTGAGAAATGGAGG + Intronic
1119507309 14:75184034-75184056 GAGGCAGCACTGAGCTATGATGG - Intergenic
1120324468 14:83007487-83007509 GTGGCAGTACTGTAAGGTGGGGG - Intergenic
1120372789 14:83658517-83658539 GTGGGAACATTCAGAGATGGGGG - Intergenic
1120696499 14:87650718-87650740 GTGGCAGGAGAGAGAGAGGGGGG - Intergenic
1120780429 14:88481401-88481423 GTGGCAGCAGTGAGGAAAGGGGG - Intronic
1121019543 14:90570861-90570883 ATGGAAGCACAGAGAGATGAAGG + Intronic
1121312433 14:92942441-92942463 GTGGCACTACTGAGAGAGGCTGG + Intronic
1121384908 14:93511087-93511109 GTGGCAGGAGGGAGAGGTGGTGG + Intronic
1121448058 14:93990652-93990674 GGGGCAGCTCTGACAGATTGGGG + Intergenic
1121456757 14:94043350-94043372 GTGGCAGCAACGAGGTATGGAGG - Intronic
1121708767 14:96021119-96021141 AGGGCAACACTGAGGGATGGGGG + Intergenic
1202905970 14_GL000194v1_random:72709-72731 CTGGCAGCAGTGAGGGCTGGTGG + Intergenic
1123464117 15:20501648-20501670 TTGGCAGGAGTTAGAGATGGTGG + Intergenic
1123653948 15:22498774-22498796 TTGGCAGGAGTTAGAGATGGTGG - Intergenic
1123896523 15:24836118-24836140 GTGAGAGCACAGAGAGAAGGTGG - Intronic
1124198241 15:27652809-27652831 GAGGCAGCACGCAGAGGTGGTGG + Intergenic
1124307855 15:28593973-28593995 TTGGCAGGAGTTAGAGATGGTGG - Intergenic
1124345832 15:28920803-28920825 ATGGCAGCACTGAGATATGGGGG - Intronic
1124376554 15:29132490-29132512 CTGCCAGCACTGGGAGCTGGGGG + Intronic
1126284748 15:46997717-46997739 CTGGCAGCACTGAGAGGAAGAGG - Intergenic
1128551616 15:68601317-68601339 TTGGCAGCACTGGGAGGTTGAGG + Intronic
1129749233 15:78049004-78049026 GTGTCAACACTGGGAGTTGGAGG + Intronic
1131281492 15:91024958-91024980 TTGGCTGCAGTGGGAGATGGAGG + Intergenic
1134803735 16:17107867-17107889 GTGGCAGCCTTGAGGGAAGGAGG + Exonic
1136146121 16:28317633-28317655 GTGGCAGGGCTGAGAGGTTGGGG + Intronic
1137531116 16:49279702-49279724 CTGGAAGCACGGAGAGGTGGGGG + Intronic
1137610376 16:49813653-49813675 GTGAATGCACAGAGAGATGGAGG - Intronic
1137730772 16:50688005-50688027 GTGGGAGTACTGAGAGCTGCGGG + Intergenic
1138134985 16:54513679-54513701 GAGGAAGCAATGAGAGATGTTGG - Intergenic
1141728519 16:85806862-85806884 GTGGAAGAAGTGAGAGATGCTGG + Exonic
1142356610 16:89604452-89604474 GGGGGAGCATTGAGAGCTGGAGG + Intergenic
1143571204 17:7759858-7759880 GTGGCAGAAGACAGAGATGGTGG - Exonic
1143674503 17:8422078-8422100 GTGGGAGCCCTGAGAAAAGGTGG + Intronic
1143694357 17:8600527-8600549 GTGGCATAAGTGAGAGACGGAGG + Intronic
1144137785 17:12314761-12314783 ATGGCAGCACTGGGAGGTAGGGG + Intergenic
1144453216 17:15398345-15398367 GTGACAGGAATGAGAGATGAAGG - Intergenic
1145722715 17:27088619-27088641 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
1146637882 17:34519514-34519536 GAGACAGCCCAGAGAGATGGGGG + Intergenic
1147121282 17:38336641-38336663 ATGACAGCACAGTGAGATGGGGG - Intronic
1148200861 17:45749281-45749303 GAGGCTGGATTGAGAGATGGTGG - Intergenic
1148806607 17:50267069-50267091 GTGGCAGCACTGAACGAGTGGGG - Intergenic
1149288667 17:55194460-55194482 GAGGCAGCAATGCGGGATGGGGG - Intergenic
1150032360 17:61752974-61752996 GTGGCAGCATTGAGAGGTGGGGG + Intronic
1150445735 17:65225834-65225856 GTGGCAGCAGTGGGAGCTGCAGG + Intronic
1151184274 17:72351837-72351859 GTGGCAGGTCTGAGAGCTGTCGG + Intergenic
1151404980 17:73880308-73880330 GTGGCAGCCCTAGGAGTTGGAGG - Intergenic
1151662813 17:75527836-75527858 GTGCAATCACTGGGAGATGGAGG + Intronic
1151843715 17:76636392-76636414 GTGGCGGAAATGAGAGAAGGAGG + Intronic
1152425737 17:80217670-80217692 GAGGCTGGACTGATAGATGGTGG + Intronic
1152755552 17:82085585-82085607 GTGGCTGCCCTGAGAGAAGGGGG - Exonic
1153553412 18:6285247-6285269 GTGGCAGCACTGAAGGATGGTGG + Intronic
1155084736 18:22446857-22446879 CTGGGAGCACTGAGAAAAGGAGG + Intergenic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1156670143 18:39458968-39458990 GGAGCAGGACTGAGAGAGGGGGG - Intergenic
1157617314 18:48994907-48994929 GTAGCAGGACGCAGAGATGGTGG + Intergenic
1158056399 18:53285733-53285755 GTGGCAGCATTGAGCGTTTGTGG - Intronic
1160131111 18:76225722-76225744 GGGGCAGCACTGGGAGGAGGAGG - Intergenic
1160291725 18:77600902-77600924 GTGGCAGCACAGAGAGGGGAAGG - Intergenic
1160520873 18:79507284-79507306 GAGGCTGCACTCAGAGCTGGTGG + Intronic
1161313486 19:3607340-3607362 GTGGGAGGACAGAGGGATGGGGG + Intergenic
1162026674 19:7898276-7898298 CTGGCAACAGTCAGAGATGGGGG + Intronic
1162806129 19:13138844-13138866 GTGGAAGCACTGGGAGGTGGTGG - Exonic
1163826344 19:19526799-19526821 CAGGCAGGACTGGGAGATGGGGG + Intronic
1164604614 19:29588833-29588855 CAGGCAGACCTGAGAGATGGAGG - Intergenic
1166184881 19:41133477-41133499 GTGGCAGCAGTGAGTGAGGTTGG - Intergenic
1166432684 19:42740557-42740579 GAGGCAGGACTGAGAGAGGAGGG - Exonic
1166435792 19:42765754-42765776 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166453063 19:42917965-42917987 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166455552 19:42937249-42937271 GAGGCAGAACTGAGAGAGGAGGG - Intronic
1166471466 19:43082742-43082764 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166482609 19:43186577-43186599 GAGGCAGGACTGAGAGAGGAGGG - Intronic
1166485091 19:43205709-43205731 GAGGCAGAACTGAGAGAGGAGGG - Exonic
1166576186 19:43840534-43840556 TTGGCTGGACTGAGAAATGGGGG + Intronic
1166642373 19:44504754-44504776 GTGGCAATATTGAGAGGTGGGGG + Intronic
927379264 2:22459169-22459191 GTGGCAGCAGATGGAGATGGAGG - Intergenic
928098967 2:28423714-28423736 ATGGCAGCGATGGGAGATGGAGG - Intergenic
929106265 2:38368836-38368858 ATCCCAGCACTGAGAGGTGGAGG + Intronic
929977596 2:46650385-46650407 GTGGAAGCACTGAGATATTCTGG + Intergenic
933633133 2:84678827-84678849 GTGGCAAAACTGAGAGATTCTGG + Intronic
934511337 2:94946759-94946781 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
934571886 2:95377758-95377780 GTGACAGTACTAGGAGATGGTGG - Intronic
936344560 2:111665350-111665372 GTGGAAACACTGTGAGGTGGGGG - Intergenic
937115841 2:119404451-119404473 GAGGCAGCACAGAGCTATGGGGG - Intergenic
937917995 2:127108433-127108455 GGGGCAGCACTGAGCGGTGGTGG - Intergenic
938054956 2:128208028-128208050 GTGGCTGAACTGAGAGGGGGTGG + Intergenic
940339142 2:152561374-152561396 GAGGCAGCACTTAGAGATCTGGG + Intronic
941402204 2:165044875-165044897 GTGGCAGCTGTGGGGGATGGGGG + Intergenic
942362242 2:175184191-175184213 GTGGCGGCACGAAAAGATGGCGG - Exonic
943675390 2:190711669-190711691 ATGGCAGTGCAGAGAGATGGAGG - Intergenic
943699309 2:190972502-190972524 GTTGCAGCTCTGAAAGAGGGTGG - Intronic
947839294 2:233197475-233197497 CTGGCAGGGCAGAGAGATGGTGG - Intronic
948844326 2:240675991-240676013 GTGGCAGAACTGGGACCTGGAGG - Intergenic
948849531 2:240698888-240698910 GTGGCAGAACTGGGACCTGGAGG + Intergenic
1170072012 20:12379611-12379633 GTGACAGAACTCAGAGATTGAGG + Intergenic
1170587993 20:17750081-17750103 TGGCCAGCACTGAGAGCTGGGGG + Intergenic
1171058885 20:21936484-21936506 GTGGGAGCACTGAGGGAGAGCGG + Intergenic
1171517723 20:25750914-25750936 GTGGCAGCACGGAGAGTCCGAGG + Intergenic
1172358371 20:34295230-34295252 GTGGCAGCACTGGGAAACGGAGG + Intronic
1173943637 20:46932931-46932953 GTGGCAGGACAGAGAGGGGGTGG - Intronic
1174095692 20:48087944-48087966 AAGGCAGGGCTGAGAGATGGAGG - Intergenic
1174132272 20:48354131-48354153 GTGGGTGCTCAGAGAGATGGTGG + Intergenic
1174402717 20:50284490-50284512 CAGGTAGCACTGAGAGATGCAGG - Intergenic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175533827 20:59693491-59693513 GTGTCATCTCTGATAGATGGGGG - Intronic
1175903971 20:62370905-62370927 GTGGCAGCCCTGGGGGAAGGCGG - Intergenic
1176238990 20:64067310-64067332 CTGACAGCACTGAGAGACTGGGG + Intronic
1176519907 21:7816505-7816527 GTGTCAGAACAGAGAGATGTGGG - Intergenic
1178038201 21:28608876-28608898 GTGGCTGCTGTGAGGGATGGGGG - Intergenic
1178653935 21:34446518-34446540 GTGTCAGAACAGAGAGATGTGGG - Intergenic
1178999845 21:37446970-37446992 GTGGTAGCAATGAGGAATGGTGG - Intronic
1179711772 21:43267646-43267668 GTGGCAGCACTGGGTCCTGGGGG + Intergenic
1179994447 21:44967502-44967524 GTGGCAGAACAGTGAGTTGGGGG - Intronic
1181388576 22:22562245-22562267 GTGGGAGGAATGAGAGATGTTGG - Intronic
1181473413 22:23154381-23154403 GTGGAAGTCCTGAGAGAAGGGGG - Intronic
1184186393 22:42867943-42867965 GTGGCAGCACTGATCCAGGGTGG + Intronic
1184669748 22:46006491-46006513 GTGGCTGCAGTGACACATGGTGG - Intergenic
1185001959 22:48251700-48251722 GTGGCAGGGCTGAGGGCTGGAGG - Intergenic
949090007 3:16170-16192 AAGGCAGAACTGAGAGAAGGTGG - Intergenic
949371041 3:3335091-3335113 CTGGCAGTACTGAGAGATGCAGG - Intergenic
950053215 3:10007615-10007637 GCAGCAGCCCTGAGGGATGGAGG + Intronic
950884253 3:16348854-16348876 GTGGCAGGACACAGAGATGATGG - Intronic
952721927 3:36542458-36542480 GTACCAGAACAGAGAGATGGAGG - Intronic
954849859 3:53591062-53591084 GAGGCAGGACTGAGTGATGTGGG - Intronic
956054988 3:65289190-65289212 GAGGCAGAGCTGAGAGATGGAGG + Intergenic
956637643 3:71382208-71382230 GAGGCAGCACTGAGCCATGATGG + Intronic
959107361 3:102079895-102079917 GTGGCAACAAGGGGAGATGGAGG - Intergenic
961807698 3:129501096-129501118 GGGGCAGCACTGAGACAGGATGG + Intronic
961963152 3:130873238-130873260 GTGGAAACATTGAGGGATGGAGG + Intronic
962362138 3:134751582-134751604 TTGGGAGCACTCATAGATGGTGG + Intronic
962854161 3:139329276-139329298 GTGGCAGGAAGGAGAGAGGGTGG + Intronic
963056338 3:141189012-141189034 GTGGCCCCACTGGGAGTTGGTGG - Intergenic
963786280 3:149537702-149537724 GGGGCAGCACTGAGGAATTGTGG - Intronic
964665720 3:159169785-159169807 GAGGCAGCACTGCAAGAGGGTGG + Intronic
966702449 3:182870118-182870140 GTGGGAGCAATGAGATATTGTGG + Intronic
968321965 3:197777777-197777799 GAGGCAGCAGTGAGCTATGGTGG - Intronic
968676061 4:1880712-1880734 TTGGCAACACTGAGAAATGTGGG + Intronic
971004893 4:22362252-22362274 TTGGCAGAACTCAGAGATGAAGG - Intronic
971842495 4:31872313-31872335 GTGGCAATATTGAGAGGTGGAGG + Intergenic
972657241 4:41076279-41076301 GAGGCAGCACTGAAAACTGGGGG + Intronic
973178533 4:47239867-47239889 GTGGCAGCAGTGAGAAAGGCCGG - Intronic
975743186 4:77450544-77450566 GTGGCATCTCTGGGAGATGGAGG - Intergenic
976964846 4:91024172-91024194 GTAGCAGTATTGAGAGGTGGGGG - Intronic
978750393 4:112239630-112239652 GTGGCAGCAGCGAGAGAAGTGGG - Intronic
979633225 4:122926952-122926974 CTGGCAGCACAGAGTGCTGGAGG + Intronic
982372062 4:154644726-154644748 GTGGAAGCCCTAAGAGATAGAGG + Intronic
984321549 4:178203546-178203568 GTGGCAGCATTGAAAAACGGGGG - Intergenic
984712667 4:182898625-182898647 GCGGGAGCCCTCAGAGATGGAGG - Intronic
984856249 4:184198478-184198500 GTGGCAGCTCCCAGAGGTGGTGG + Intronic
985759003 5:1735157-1735179 CCGGCAGCTCTTAGAGATGGGGG + Intergenic
986290135 5:6393142-6393164 GTGGCAGGAGAGAGAGAGGGAGG - Intergenic
987261027 5:16203667-16203689 GTGGCAGAAGAGAGAGATAGTGG - Intergenic
989228669 5:39061393-39061415 GTGGAAGGTCTGAGTGATGGTGG + Intronic
989810613 5:45668384-45668406 GTGGCAGGAGAGAGAGATTGAGG - Intronic
991516250 5:67438856-67438878 GAGGGAGGACTGAGAGATGGGGG - Intergenic
992904731 5:81334895-81334917 GTGGCAGGAGTGGGAGATGTAGG + Intronic
997883447 5:137611049-137611071 GTGGAAGCACTGAGAGAGTCAGG - Intergenic
998530157 5:142876918-142876940 GTGGCAGCAGTGGGGGTTGGTGG + Intronic
999413934 5:151378674-151378696 GTGGCAGTAATGGCAGATGGTGG - Intergenic
999609090 5:153350169-153350191 ATGGAAGGACTGAGTGATGGAGG + Intergenic
999796056 5:154990775-154990797 AAGGCAGCTTTGAGAGATGGCGG + Intergenic
999819879 5:155216055-155216077 GTGGTAGCAATGAGATTTGGAGG + Intergenic
1001177149 5:169480937-169480959 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1002457999 5:179356594-179356616 CTGGCAGCACAGAGACAAGGGGG - Intergenic
1002571319 5:180140772-180140794 GTGGCTGCACTGAGGGCTGACGG + Intronic
1005349418 6:24919528-24919550 CTGGCAGGAGTGAGAGTTGGGGG + Intronic
1006521626 6:34574332-34574354 GTGGCAGCAGTGAGTGTTGTGGG - Intergenic
1006639806 6:35484158-35484180 GTGGCGGGGCTGAGAGAGGGTGG - Intronic
1006749822 6:36369839-36369861 GAGGCAGCAGTGAGCTATGGTGG + Intronic
1007433940 6:41794890-41794912 CAGGCAGCACTGAGACATGGAGG - Exonic
1007741210 6:44010657-44010679 GTGCCAGCACTGAGAGACCGAGG - Intergenic
1008441555 6:51537547-51537569 GTGGCAGTGCAGAAAGATGGAGG + Intergenic
1011368190 6:86603591-86603613 GAGTCAGCAATGGGAGATGGGGG + Intergenic
1011746220 6:90410317-90410339 GAGACAGAACTGAGAGATGGGGG - Intergenic
1011984704 6:93428779-93428801 GTGGCAGCAATGATAGCTGAGGG - Intergenic
1012616466 6:101284374-101284396 GTGCCATCCCAGAGAGATGGAGG - Intergenic
1012652613 6:101775368-101775390 TAGGCAGCACTGAGTGATAGTGG - Intronic
1013273231 6:108560982-108561004 GCGGCAGGACTGGGAGGTGGCGG + Exonic
1013845655 6:114447814-114447836 GTGGCAGGAGTGAGAGAGTGAGG + Intergenic
1014169738 6:118265645-118265667 GTGGCAGAAGTGGGAGAGGGTGG + Intronic
1014431947 6:121381445-121381467 GTGGCAGTGCAGAAAGATGGCGG - Intergenic
1015007855 6:128305991-128306013 GTGGCAGGACAGAGTGAAGGGGG + Intronic
1015482402 6:133727281-133727303 CTAGCAGGACTGAGAGATGAAGG + Intergenic
1017563411 6:155658155-155658177 GTGGCAGCCTTGATAGAAGGAGG + Intergenic
1017881838 6:158567495-158567517 TGGGCAGCCGTGAGAGATGGAGG + Intronic
1018739878 6:166719951-166719973 GTGGCAGCTTTGAGATATGTGGG + Intronic
1019959621 7:4448347-4448369 GGGGCTGAAGTGAGAGATGGGGG - Intergenic
1020469646 7:8521542-8521564 ATGGCAGCATTGCCAGATGGAGG + Intronic
1022220590 7:28309826-28309848 GTGGCAGAAATCAGAGAAGGAGG - Intronic
1025265927 7:57456962-57456984 GTGGCAGCTCTGAAAGGAGGAGG - Intronic
1027055077 7:75044072-75044094 ATGGCCTCACTGAGACATGGAGG + Intronic
1029032776 7:97486279-97486301 GTGGCAGTATTGAGAGGTGAGGG - Intergenic
1029617480 7:101668215-101668237 GTGGAAGCACTGGGACAAGGGGG - Intergenic
1030065568 7:105656360-105656382 ATGTCAACACTGTGAGATGGTGG + Intronic
1030082716 7:105791293-105791315 GTGGCAGTAGGGAGAGATGAGGG - Intronic
1030541712 7:110838448-110838470 ATGGCAGTACTGAAAGATGGGGG + Intronic
1032537651 7:132678132-132678154 GAGGCAGCAGGGAGAGAAGGGGG - Intronic
1033317692 7:140311631-140311653 GGGGTTGCAGTGAGAGATGGGGG - Intronic
1034683200 7:152946998-152947020 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1034816123 7:154173555-154173577 GTGGAAGCACACAGAGAAGGGGG - Intronic
1034929923 7:155153529-155153551 GTGGCAGCTGTGACAGATGCAGG - Intergenic
1035285617 7:157804814-157804836 GAGGCAGGACTGGGAGAAGGGGG - Intronic
1037379182 8:18266074-18266096 GTGATAGCACTGAGTGATGCTGG - Intergenic
1037580052 8:20239746-20239768 GTGGCAGAGCTGAGAGAGGGGGG + Intergenic
1037731176 8:21525183-21525205 CTGGCAGCAATGAGAGTTTGAGG - Intergenic
1039176272 8:34810366-34810388 GTTGCAGCAGAAAGAGATGGAGG + Intergenic
1040288162 8:46110918-46110940 GGGACAGCCCTGAGAGATTGTGG + Intergenic
1044230387 8:89769394-89769416 TTGGCAGCTCTGTGAGATGTAGG + Intronic
1044923896 8:97193434-97193456 GTGGCAGTATTGGGAGGTGGGGG + Intergenic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1047527147 8:125643330-125643352 GTGGGGGAACTGAGAAATGGAGG - Intergenic
1047917367 8:129596305-129596327 GAGGCAGGAGAGAGAGATGGGGG - Intergenic
1048376578 8:133827899-133827921 GTGATAGCCATGAGAGATGGGGG + Intergenic
1049330246 8:142046605-142046627 GTGGCAGGAGGGAGAGTTGGTGG + Intergenic
1049416493 8:142497847-142497869 GTGGCAGCTTTCAGAGCTGGAGG + Intronic
1050356895 9:4792584-4792606 GTGGTAGCAAGGGGAGATGGCGG - Intergenic
1050819909 9:9865282-9865304 GTGGCAGTATTGAGAGGCGGAGG + Intronic
1051731792 9:20151485-20151507 GAGGAAGCACTTACAGATGGTGG - Intergenic
1052894586 9:33735224-33735246 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1052894592 9:33735254-33735276 GTGGCTGCTGTGGGAGATGGAGG - Intergenic
1053032076 9:34789007-34789029 GTGGCAGTAATGAGCGATGCAGG + Intergenic
1053654037 9:40197508-40197530 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1053728175 9:41025534-41025556 GTGGCAGTATCGAGAGGTGGGGG + Intergenic
1053904425 9:42826685-42826707 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1054356963 9:64071187-64071209 CTGGCAGCAGTGAGGGCTGGTGG + Intergenic
1054530560 9:66178829-66178851 GTGGCAGAAAAGAAAGATGGTGG - Intergenic
1054673781 9:67833454-67833476 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1054700335 9:68406552-68406574 GTGGCAGTATCGAGAGGTGGGGG - Intronic
1055716301 9:79121803-79121825 CTGGCAGGACTGAGAGATGGTGG - Intergenic
1056783827 9:89573673-89573695 GTGGCATTACAGAGAGCTGGGGG - Intergenic
1057379586 9:94555739-94555761 GTGGCAGAAAAGAAAGATGGTGG + Intergenic
1057569456 9:96193464-96193486 GTGGCAGCGTTGGGAGGTGGGGG - Intergenic
1058515962 9:105776233-105776255 GTGACAGCACTGAGGGAAGCTGG - Exonic
1059357411 9:113710647-113710669 CTGGCAGAAAGGAGAGATGGAGG + Intergenic
1060571284 9:124642801-124642823 GTGGAAGCCATGAGAGAGGGAGG + Intronic
1061184061 9:129041853-129041875 GAGGCATCACTGAGAAATGGGGG + Intronic
1061368059 9:130182741-130182763 GTGCCAGCACCGTAAGATGGCGG - Intronic
1061677057 9:132223397-132223419 CTGGCAGGACTGAGATATGAGGG + Intronic
1062025372 9:134337917-134337939 GTGCCAGCCCTGAGAGGTGGCGG + Intronic
1062063483 9:134512818-134512840 GTGGAAGAACTGAGAGGAGGGGG - Intergenic
1062339362 9:136087150-136087172 GTGGCAGCCTTGGGAGCTGGAGG + Intronic
1062413105 9:136434550-136434572 GTGGGAGCTCTGGGGGATGGGGG + Intronic
1062423070 9:136493374-136493396 GTGGCTGTACTGAGTGATGCCGG + Intergenic
1203748507 Un_GL000218v1:57926-57948 CTGGCAGCAGTGAGGGCTGGTGG + Intergenic
1203561218 Un_KI270744v1:60094-60116 CTGGCAGCAGTGAGGGCTGGTGG - Intergenic
1186196488 X:7114519-7114541 GTGGCAGTATTGAGAGGTGTGGG - Intronic
1188781027 X:34285235-34285257 GTGGCAGCAGTTAGAGAAAGTGG - Intergenic
1189331093 X:40145570-40145592 GAGGCAGCACGGAGAGTTTGGGG - Intronic
1190455948 X:50628001-50628023 TTGCCTGCACAGAGAGATGGAGG + Intronic
1191223255 X:58014231-58014253 GTGGCTGCTGTGGGAGATGGGGG + Intergenic
1192319615 X:70079123-70079145 GTGGCAGCAGGGAGAGAGGAGGG + Intergenic
1192370434 X:70508397-70508419 ATGGCAGCACTTAGGGGTGGGGG - Intergenic
1194466212 X:94237689-94237711 GTGGCTGCTGTGAGGGATGGGGG + Intergenic
1199907853 X:152252905-152252927 GTGTCAGCTCTGAGAGAGGATGG - Intronic
1201306696 Y:12556637-12556659 GTGGCTGCTGTGGGAGATGGGGG - Intergenic
1201569172 Y:15396037-15396059 GTGGCAGTATTGAGAGGTGTGGG - Intergenic