ID: 1098898119

View in Genome Browser
Species Human (GRCh38)
Location 12:76085045-76085067
Sequence TTCCCAGCACAACGCCGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098898119_1098898125 4 Left 1098898119 12:76085045-76085067 CCCCTTCGGCGTTGTGCTGGGAA 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1098898125 12:76085072-76085094 CAGGGCTGGCGCCAGTCGCCTGG 0: 1
1: 0
2: 1
3: 9
4: 153
1098898119_1098898124 -10 Left 1098898119 12:76085045-76085067 CCCCTTCGGCGTTGTGCTGGGAA 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1098898124 12:76085058-76085080 GTGCTGGGAACGCTCAGGGCTGG 0: 1
1: 0
2: 0
3: 22
4: 213
1098898119_1098898130 30 Left 1098898119 12:76085045-76085067 CCCCTTCGGCGTTGTGCTGGGAA 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098898119 Original CRISPR TTCCCAGCACAACGCCGAAG GGG (reversed) Intergenic
901442918 1:9290489-9290511 TTTCCAGATTAACGCCGAAGGGG + Intergenic
903219659 1:21862091-21862113 ATGCCAGCACAACGCCGCAGGGG - Exonic
912639753 1:111333495-111333517 TTCCCAGCACATCTCCAAACTGG + Intergenic
915979154 1:160409377-160409399 TTCCCAGCACCAAGCTGAAAGGG - Intronic
920857636 1:209675786-209675808 GGCCGAGCACCACGCCGAAGAGG - Exonic
924342602 1:243050982-243051004 TTCCCAGCACATGGCCGGTGAGG + Intergenic
1068324065 10:55460834-55460856 GTCCCAGAACAAAGCCCAAGTGG - Intronic
1068586308 10:58803182-58803204 TGCCCAGCAAAACTCCGAAAGGG + Exonic
1068880952 10:62048258-62048280 TGCCCAGCACAACACCCAAAAGG - Intronic
1077930250 11:6723904-6723926 TTCCCAGGACCACACAGAAGTGG + Intergenic
1079250225 11:18781565-18781587 ATCCCAGCACCAGGCCGAGGCGG - Intronic
1079381517 11:19942341-19942363 TTCCCAGCACGACCCACAAGAGG + Intronic
1079759759 11:24314088-24314110 TTCACAGCATAAGGCCGATGGGG + Intergenic
1083336103 11:61922738-61922760 TTCGCAGCCCAAAGCCCAAGTGG - Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1111858211 13:93667678-93667700 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1121820769 14:96964312-96964334 CTCCCAGCACACAGCCGAGGGGG - Intergenic
1122878664 14:104680185-104680207 TTCCCTGCACACAGCTGAAGTGG + Intergenic
1123913891 15:25000893-25000915 ATCCCAGCACGAGGCCGAGGTGG + Intergenic
1132295079 15:100728806-100728828 TTCCCAGCACAAGCCCTACGTGG + Intergenic
1132844081 16:1992078-1992100 GGCCCAGCGCGACGCCGAAGCGG - Exonic
1134395351 16:13857681-13857703 TTCCCATCACAAAGGCTAAGGGG - Intergenic
1136736833 16:32474213-32474235 TTCCCAGCTCAGTGCCAAAGAGG - Intergenic
1139108264 16:63856063-63856085 TTCACAGCACCACGCTGAGGAGG + Intergenic
1141046701 16:80721914-80721936 TTCCAGGCACAGCGACGAAGAGG + Intronic
1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1153815607 18:8787453-8787475 TCCCCAGCACATCCCCGGAGGGG + Intronic
1158033710 18:52999119-52999141 TTCACTGCACAAAGCAGAAGTGG - Intronic
1163183190 19:15618339-15618361 TTCCCAGAACAACACGGAGGTGG - Intronic
1167700049 19:51037877-51037899 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
926516583 2:13853806-13853828 TTCCCAGAATAACACAGAAGTGG + Intergenic
928260414 2:29761621-29761643 TTCCCAGCAGACAGCAGAAGAGG - Intronic
932359861 2:71095434-71095456 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
938371147 2:130768965-130768987 TTCCCAGCACAACGTGGCAGTGG - Intergenic
941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG + Intergenic
943568183 2:189541692-189541714 TTCCCAGGACAAAGCTGAAGCGG - Intergenic
1173454307 20:43190611-43190633 TCCCCACCACCACGCGGAAGGGG + Intergenic
1175893160 20:62324180-62324202 CTGCCAGCACAACACCGAAGGGG - Exonic
1176004106 20:62850467-62850489 TTCCCATCACAACCCCCAACTGG + Intronic
1179397176 21:41051419-41051441 TTCCCAACACAACACCCTAGGGG + Intergenic
1184051544 22:42009161-42009183 ATCCCAGCACAAGGCCAAGGTGG - Intronic
1185293129 22:50037450-50037472 ATCCCAGCACTAGGCCGAGGCGG - Intronic
954659248 3:52218151-52218173 TTCCCAGCACAAGGAAGTAGAGG - Intergenic
956010493 3:64826093-64826115 TTAACAGCAAAACACCGAAGTGG - Intergenic
959408127 3:105986776-105986798 ATCCCAGCACTAGGCCGAGGTGG + Intergenic
961435377 3:126912907-126912929 TTCCCTGCAGAAGGCCGAGGGGG + Intronic
983002711 4:162438236-162438258 TTCACAGCACCACTCCTAAGCGG - Intergenic
989455454 5:41638342-41638364 TTCCTACCACAAAGCCCAAGTGG + Intergenic
991977884 5:72200439-72200461 TTCCCAGTACAAAGCCAAACAGG - Intronic
994707427 5:103223435-103223457 TTATCAGCAGAACGCCGACGTGG - Intergenic
1004025479 6:11814255-11814277 TTCCCAGCAGAACTGAGAAGAGG + Intergenic
1006457575 6:34140724-34140746 TTTCCAGCACAAGACCCAAGTGG + Intronic
1024075918 7:45817790-45817812 TTCCCAGCACATGGCCGGTGAGG - Intergenic
1024254653 7:47531773-47531795 TTCCCACCCCAACTCAGAAGGGG - Intronic
1024647682 7:51383502-51383524 TTCCCAGCACATGGCCGGTGAGG + Intergenic
1025071576 7:55904212-55904234 ATCCCAGCACCAGGCCGAGGCGG + Intronic
1036223817 8:6942125-6942147 TGCCCAGCACCACCCTGAAGTGG + Intergenic
1056985994 9:91364185-91364207 TTCCCACCCCAACTCAGAAGGGG - Intergenic
1057243397 9:93433013-93433035 TGCCCAGCATAACGATGAAGAGG - Intergenic
1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG + Intergenic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1194380142 X:93181217-93181239 TTCCCACCTCAACTCAGAAGGGG - Intergenic
1195179221 X:102340098-102340120 TTCCCACCAGAACTTCGAAGGGG + Intergenic
1198999982 X:142624256-142624278 TTGCCATGACAACGCCAAAGGGG + Intergenic
1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG + Exonic