ID: 1098898130

View in Genome Browser
Species Human (GRCh38)
Location 12:76085098-76085120
Sequence CTCGCTCGCCGCAGCCTAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098898121_1098898130 28 Left 1098898121 12:76085047-76085069 CCTTCGGCGTTGTGCTGGGAACG 0: 1
1: 0
2: 0
3: 4
4: 34
Right 1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG 0: 1
1: 0
2: 0
3: 1
4: 33
1098898120_1098898130 29 Left 1098898120 12:76085046-76085068 CCCTTCGGCGTTGTGCTGGGAAC 0: 1
1: 0
2: 1
3: 2
4: 42
Right 1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG 0: 1
1: 0
2: 0
3: 1
4: 33
1098898119_1098898130 30 Left 1098898119 12:76085045-76085067 CCCCTTCGGCGTTGTGCTGGGAA 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG 0: 1
1: 0
2: 0
3: 1
4: 33
1098898126_1098898130 -8 Left 1098898126 12:76085083-76085105 CCAGTCGCCTGGTCCCTCGCTCG 0: 1
1: 0
2: 0
3: 6
4: 100
Right 1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098898130 Original CRISPR CTCGCTCGCCGCAGCCTAGA CGG Intergenic
920704817 1:208243498-208243520 CTCGCCCGCCGCGGCCAAGCCGG + Intronic
1076116868 10:127907113-127907135 CCCGCTGTCCGCAGCCTAGCAGG - Exonic
1083605258 11:63974879-63974901 CTCGCGCCCCGCAGCGTAGCGGG + Intronic
1088893122 11:114059869-114059891 CTCACTCACCGCAGCCGAGCCGG - Exonic
1098898130 12:76085098-76085120 CTCGCTCGCCGCAGCCTAGACGG + Intergenic
1108409103 13:50129945-50129967 CTCGCCCGAGGCAGCCTAGAGGG - Intronic
1113921832 13:113917677-113917699 CTCGGTGGCCTCAGCCGAGATGG - Intergenic
1119772280 14:77227698-77227720 CTGGGTCGCCCCACCCTAGAGGG - Intronic
1139801632 16:69527526-69527548 CTCACTAGCCTCATCCTAGAGGG - Intergenic
1145919450 17:28599373-28599395 CTCTCCAGCCGCAGCCTTGACGG + Intronic
1151983703 17:77528816-77528838 CCCGCGCGCAGCAGCCTGGAGGG - Intergenic
1155152855 18:23136089-23136111 CTTGCTCGCCGCTGCCGAGCGGG + Exonic
1160603903 18:80034494-80034516 CCCGCCCGCCGCAGCCCACATGG - Exonic
1162805525 19:13136218-13136240 CTCTCTCCCTGCAGCCGAGAAGG + Exonic
1168305689 19:55433788-55433810 CCCTCTCCCCGCAGCCGAGAAGG - Exonic
935275694 2:101474038-101474060 CTCGCCCGCCGCAGCGCGGAGGG - Intronic
946247221 2:218394746-218394768 CTTGCTGGCCGCAGCCTACCTGG + Exonic
1173664459 20:44754661-44754683 CTCGCTGGCCTGGGCCTAGATGG - Intronic
1175321950 20:58094487-58094509 CTCCCCAGCCACAGCCTAGAAGG + Intergenic
1179918288 21:44492353-44492375 CAGGTTCGCCGCAGCCTGGAGGG - Intergenic
1183329909 22:37213779-37213801 CTCTCTCGCCGCAGCCCACCTGG + Intergenic
949944587 3:9179980-9180002 CTCGCAGGCTGCAGCCTGGAAGG - Intronic
977012340 4:91653534-91653556 CTCGCTGGCAGCAGATTAGATGG - Intergenic
990191801 5:53267991-53268013 CTCGCTGGGGGCAGCCAAGATGG + Intergenic
990952334 5:61310830-61310852 CTCGGTCCCCTCAGCCTAGCAGG - Intergenic
992228237 5:74639942-74639964 GTCGCTCCCCGCAGCCTCCAGGG - Intronic
1001957262 5:175856608-175856630 CTCGCATGCCGCAGCCCACACGG - Intronic
1006525131 6:34597804-34597826 CTCACTCACCGCAGCCAAGCTGG + Intronic
1012912776 6:105136757-105136779 CTCGCTGGCCGCGCCCTCGAGGG - Intronic
1022470488 7:30679109-30679131 CTCAGTCCCCTCAGCCTAGAGGG + Intronic
1038399767 8:27274642-27274664 CTCGCTAGGCACAGCCCAGAAGG - Intergenic
1047546451 8:125822084-125822106 CTCTCTCTCCCCAGCCTATATGG + Intergenic
1057783633 9:98070879-98070901 ATAGCTCACCGCAGCCTTGACGG + Intronic
1062577014 9:137213620-137213642 CACGCTGGCCGCACCCTAGGAGG - Intronic
1191864965 X:65696632-65696654 CTCGCTCACCTCAGCATTGAGGG + Intronic