ID: 1098905187

View in Genome Browser
Species Human (GRCh38)
Location 12:76154606-76154628
Sequence AAGCCTACTCTCACAGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098905187_1098905188 10 Left 1098905187 12:76154606-76154628 CCATGGGCTGTGAGAGTAGGCTT No data
Right 1098905188 12:76154639-76154661 AAGCTTCCATGATGTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098905187 Original CRISPR AAGCCTACTCTCACAGCCCA TGG (reversed) Intergenic
No off target data available for this crispr