ID: 1098917032

View in Genome Browser
Species Human (GRCh38)
Location 12:76268116-76268138
Sequence TTGGGATTTATTTGGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098917032_1098917038 13 Left 1098917032 12:76268116-76268138 CCTGGGATCCAAATAAATCCCAA No data
Right 1098917038 12:76268152-76268174 TGTGTTCCCTTCTCTACTTTGGG No data
1098917032_1098917037 12 Left 1098917032 12:76268116-76268138 CCTGGGATCCAAATAAATCCCAA No data
Right 1098917037 12:76268151-76268173 TTGTGTTCCCTTCTCTACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098917032 Original CRISPR TTGGGATTTATTTGGATCCC AGG (reversed) Intergenic
No off target data available for this crispr