ID: 1098917038

View in Genome Browser
Species Human (GRCh38)
Location 12:76268152-76268174
Sequence TGTGTTCCCTTCTCTACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098917034_1098917038 -5 Left 1098917034 12:76268134-76268156 CCCAACTTCCTTTTCACTTGTGT No data
Right 1098917038 12:76268152-76268174 TGTGTTCCCTTCTCTACTTTGGG No data
1098917033_1098917038 5 Left 1098917033 12:76268124-76268146 CCAAATAAATCCCAACTTCCTTT No data
Right 1098917038 12:76268152-76268174 TGTGTTCCCTTCTCTACTTTGGG No data
1098917032_1098917038 13 Left 1098917032 12:76268116-76268138 CCTGGGATCCAAATAAATCCCAA No data
Right 1098917038 12:76268152-76268174 TGTGTTCCCTTCTCTACTTTGGG No data
1098917035_1098917038 -6 Left 1098917035 12:76268135-76268157 CCAACTTCCTTTTCACTTGTGTT No data
Right 1098917038 12:76268152-76268174 TGTGTTCCCTTCTCTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098917038 Original CRISPR TGTGTTCCCTTCTCTACTTT GGG Intergenic
No off target data available for this crispr