ID: 1098921298

View in Genome Browser
Species Human (GRCh38)
Location 12:76304571-76304593
Sequence ATGCTGTTCTTCTGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 277}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098921298_1098921302 -7 Left 1098921298 12:76304571-76304593 CCTTTCTTCCAGAAGAACAGCAT 0: 1
1: 0
2: 3
3: 27
4: 277
Right 1098921302 12:76304587-76304609 ACAGCATTTAGCTGGGCCTATGG 0: 1
1: 0
2: 2
3: 16
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098921298 Original CRISPR ATGCTGTTCTTCTGGAAGAA AGG (reversed) Intergenic
901624529 1:10616486-10616508 GTGCTGCTCATCTGGGAGAAAGG - Intronic
904714617 1:32457968-32457990 ATGGTGATCTTCTGGGAGCAGGG + Intergenic
906522156 1:46474062-46474084 ATGGTGTCCTTGTGGAAGCAGGG + Intergenic
907656395 1:56346515-56346537 ATGCTTTTCTTCTGTATCAATGG - Intergenic
908504361 1:64781199-64781221 ATGTAGTTCTTCTTGAAGACAGG - Intronic
909236766 1:73162449-73162471 ATGCTCTTCTTCTGGGAGTCTGG + Intergenic
909410666 1:75347058-75347080 ATTAAGTTCTTCTGTAAGAAGGG + Intronic
909884838 1:80928283-80928305 GCTCTGTTCTTCTGGAAAAAAGG + Intergenic
910361999 1:86422267-86422289 ATGGTGCTCTCCTTGAAGAATGG - Intergenic
910507512 1:87966830-87966852 ATGCTGATCTCCTGCAAGAAGGG + Intergenic
910535007 1:88287736-88287758 ATTCTGTTTTTCTAGAAAAAAGG + Intergenic
911094025 1:94041279-94041301 AAGCAGTTCTTCAGGAAGAGTGG + Exonic
912093957 1:106116231-106116253 ATCTTGTTGTTCTGAAAGAAGGG + Intergenic
913159196 1:116129955-116129977 AGGCTGTTCTCCTGGATGGAGGG + Intronic
913460129 1:119076597-119076619 TTGCTGTCTTTCTGGAACAAAGG + Exonic
913707038 1:121435261-121435283 ATGCTGTGGTTCTTGCAGAATGG - Intergenic
915233430 1:154463262-154463284 ATGGAGTTCTCCTGTAAGAAAGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917638839 1:176962504-176962526 ATGATGTTCTTCTTGAGGGAAGG - Intronic
919044089 1:192429629-192429651 ATGCTGTTCTTGTGATAGTAAGG + Intergenic
921347283 1:214199464-214199486 AAGCTGTGCCTCTGGAGGAATGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
921946141 1:220887321-220887343 TTACAGTTCATCTGGAAGAAGGG + Intergenic
922181282 1:223234929-223234951 ATGTTGTTCTCCTGCAATAAAGG - Intronic
922382348 1:225043525-225043547 ATGTTGTTCCTCTTGATGAACGG - Intronic
922921010 1:229303445-229303467 ATGCTCTTGTTCAGAAAGAAAGG + Intronic
923103669 1:230837684-230837706 TTGCTGTGCTTTTGGAAGAAGGG - Exonic
923472763 1:234306921-234306943 ATGATGTTCTTCTCTTAGAAAGG + Intronic
923813697 1:237349426-237349448 ATGGGGTTCTTCAGGCAGAAAGG + Intronic
1063559284 10:7111522-7111544 CCCCTGTTCTTCTGGAAGGATGG + Intergenic
1063666573 10:8064193-8064215 AAGCTGTCCTTCCGGAAGAGAGG - Intronic
1063688233 10:8258730-8258752 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
1067773141 10:49141733-49141755 ATGCCATTCTTGTGGAGGAAAGG - Intergenic
1067797227 10:49329400-49329422 ATTCTGTGCTTCAGGAAGACAGG - Intergenic
1067823067 10:49547928-49547950 AAGATGTTTTTCTGGAAAAAAGG - Intergenic
1068103893 10:52590697-52590719 AGGCTCTTCTGCTTGAAGAAAGG - Intergenic
1068422033 10:56807360-56807382 ATGCTGTGCTTCTTGTAGACTGG + Intergenic
1071864011 10:89705276-89705298 TTGCTGTTATTCTTGCAGAATGG + Exonic
1072255672 10:93618074-93618096 GTGCTGGCCTTCTGGAGGAAGGG + Intronic
1074173236 10:110966840-110966862 TTGCTGTACTTCTGTAAAAATGG + Intronic
1074192498 10:111150063-111150085 ATGCTGATTTTCTGAAAGATGGG + Intergenic
1074429806 10:113384841-113384863 ATGTGGTTCTTCTGAAAGCAAGG - Intergenic
1075318444 10:121470411-121470433 ATGCGGTTCTTCCGGAAGGAAGG - Intergenic
1076503705 10:130957512-130957534 ACTCTGGTCTTCTGGATGAATGG - Intergenic
1076674476 10:132141043-132141065 TAGCCGTCCTTCTGGAAGAAGGG - Intronic
1077962776 11:7091998-7092020 ATGGTGTTATTCGGGAAGAGGGG - Intergenic
1079759299 11:24309248-24309270 ATGCTGTTCTTGTGGTAGTGAGG + Intergenic
1079870029 11:25785693-25785715 ATTATGTTCTTGTGGAAAAAAGG - Intergenic
1080413248 11:32045929-32045951 ATGCTGTTCTTGTGATAGAGAGG - Intronic
1087533560 11:99414766-99414788 ATCTTGCTATTCTGGAAGAATGG + Intronic
1091158795 11:133400019-133400041 GTGATGTTCTTATGGAAGACAGG - Intronic
1091946491 12:4549563-4549585 CTCCTGTCCTTCTGGAACAACGG + Intronic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093393841 12:18656121-18656143 TTGCTGTTTTTGTGGAAGAATGG - Intergenic
1094053844 12:26248426-26248448 ATACTGTTCTTCTGAAAGGATGG + Intronic
1094331719 12:29301428-29301450 AAGCTGTTATTCTGGAAAACTGG - Intronic
1095809976 12:46362935-46362957 ATTTTCATCTTCTGGAAGAAGGG - Intronic
1097611715 12:61831599-61831621 ATACTGTTTTTCTGGAAGACTGG + Intronic
1097840976 12:64320840-64320862 AATCTGTTCTTCTGGAAAACTGG - Intronic
1098144827 12:67487742-67487764 ATGCTGTTCTTGTGATAGCAAGG - Intergenic
1098807605 12:75039442-75039464 ATGATGTGCTTCTGAAAGAGAGG + Intergenic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099257030 12:80327218-80327240 ATGCTTTTCTTCTAAAGGAATGG - Intronic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1100082970 12:90875618-90875640 AAGCTGTTCTTCTGGCAAAAAGG - Intergenic
1100491529 12:95084201-95084223 ATGCTGCTCTGCTGAAAGGAAGG - Intronic
1101473151 12:105018428-105018450 ATTCCTTTCTTTTGGAAGAAAGG + Intronic
1102182147 12:110920694-110920716 ATGCCGTTCTTCTGAAGTAAGGG + Intronic
1102749960 12:115284172-115284194 ATGGTGTTCTTCTGTTATAAAGG - Intergenic
1106508444 13:30392196-30392218 ATGCTGTTTGTCTGGGGGAAAGG - Intergenic
1107230694 13:38106191-38106213 ATGCTTTTCTTTTTGAATAAAGG + Intergenic
1108709905 13:53022819-53022841 ATGCTGTTCTTCTGATGAAAGGG + Intergenic
1109021330 13:57096549-57096571 AGAATGTTCTTTTGGAAGAAAGG + Intergenic
1109241293 13:59892452-59892474 AAGCATTTCTTCAGGAAGAAAGG + Intronic
1110097560 13:71548332-71548354 ATGATGTTTTTATGGAATAAAGG - Intronic
1111764667 13:92513147-92513169 ATACTGTTCTTCTAGGAGAAGGG + Intronic
1111956669 13:94766469-94766491 ATGTTGTTTTTGTGTAAGAAAGG - Intergenic
1112386489 13:98944977-98944999 ATGCTGATCTTCTTGAAGTTTGG + Intronic
1112742386 13:102489729-102489751 ATGCTGTTCTCGTGGTAGCAAGG + Intergenic
1112766073 13:102745252-102745274 TTGCTCTTCATCTTGAAGAAGGG + Exonic
1112780752 13:102898100-102898122 TGGCTGTTCTTCTGGTGGAATGG + Intergenic
1113036969 13:106061524-106061546 ATGCAGGTCTTATGGAAGAATGG - Intergenic
1113236794 13:108284980-108285002 ACTCTGTTCTGCTGGAAGTATGG - Intronic
1114990030 14:28274781-28274803 ATGCTCTTCTTCTTGGGGAAGGG - Intergenic
1115146221 14:30229108-30229130 CTGCTGTGGTTCTGAAAGAATGG - Intergenic
1115352627 14:32411603-32411625 ATCTTGTTCCCCTGGAAGAAGGG - Intronic
1115696164 14:35900960-35900982 CTGCTGTTGTTCTGGAACACTGG + Intronic
1117457389 14:55912053-55912075 ATGCTGTTCTTCTGGACCACAGG + Intergenic
1118083208 14:62386282-62386304 ATGCTGTTCTTGTGGTAGTGAGG + Intergenic
1118356951 14:65021970-65021992 TGGCTGCTGTTCTGGAAGAATGG - Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1118550421 14:66944043-66944065 ATCTTGTTTTTCTGGAAAAAGGG - Intronic
1119071061 14:71584599-71584621 AAGCATTTCTTCTGGAAGAATGG + Intronic
1119801528 14:77449492-77449514 ATGCTGTCTTTGGGGAAGAACGG - Intronic
1121373404 14:93381994-93382016 ATGCTGCCTTTCTGGAGGAAAGG + Intronic
1121797683 14:96748732-96748754 AAGATGTTCTTCTGGAAAGAGGG + Intergenic
1123680692 15:22761187-22761209 AAGCTTTTCATCTTGAAGAAGGG + Intergenic
1124067031 15:26354185-26354207 AAAATGTTCTTCTGGAGGAAGGG + Intergenic
1124332902 15:28835645-28835667 AAGCTTTTCATCTTGAAGAAGGG + Intergenic
1125314461 15:38416447-38416469 ATTCAGTGATTCTGGAAGAAGGG - Intergenic
1125836656 15:42758148-42758170 ATTCTTTTCATTTGGAAGAAAGG - Intronic
1128411407 15:67402467-67402489 ACGATGGTCTTCTGGAACAAAGG - Intronic
1129536295 15:76315970-76315992 CAGCTGGTCTTCTGGAGGAATGG + Intergenic
1131930970 15:97440730-97440752 ATTCTGTTTTTCTGAAAAAATGG + Intergenic
1132216298 15:100064018-100064040 ATGCTGATGTTCTGGTTGAAGGG - Intronic
1134559078 16:15192114-15192136 ATACTTTGCTTCTGGGAGAAGGG - Intergenic
1134815737 16:17204295-17204317 ATGCTTTTCTTTTGGAGAAAGGG + Intronic
1134919615 16:18103727-18103749 ATACTTTGCTTCTGGGAGAAGGG - Intergenic
1136866042 16:33755384-33755406 CTGCTTTTCTTCTGGAAGTGTGG + Intergenic
1137838421 16:51617134-51617156 ATGTTATTCATCTGAAAGAAAGG + Intergenic
1138165810 16:54800708-54800730 AAGCCTTTCTTCTGGAAGCAAGG + Intergenic
1138174092 16:54880478-54880500 CTGCTGGTGTTCTGGAAGCAGGG - Intergenic
1138313165 16:56045449-56045471 ATGCTGTTTTTCTGACAAAAGGG + Intergenic
1139135422 16:64198347-64198369 ATGCCTTTCTACTGGAGGAATGG + Intergenic
1203106112 16_KI270728v1_random:1360719-1360741 CTGCTTTTCTTCTGGAAGTGTGG - Intergenic
1203127402 16_KI270728v1_random:1601649-1601671 CTGCTTTTCTTCTGGAAGTGTGG + Intergenic
1144380517 17:14692663-14692685 AAGCTGTTCTTCAGAAATAAAGG - Intergenic
1147053745 17:37817947-37817969 ATGCTGTTCTTCTTCTAGACAGG + Intergenic
1147217155 17:38907532-38907554 ATGTTCCTCTTCTGGAAGATGGG + Intronic
1147731522 17:42606632-42606654 ATGCTGTTCTTTTTGAGGAGGGG - Intronic
1148694041 17:49548515-49548537 AACCTGTTCTTCAGGAAGCAAGG - Intergenic
1150325207 17:64251513-64251535 ATAATGTTCTTTTGGAAGGAAGG - Intronic
1150513102 17:65776991-65777013 ATTTTATTCTTATGGAAGAAGGG - Intronic
1150618790 17:66792978-66793000 ATGATGATTTTCTGGAAGATGGG + Intronic
1151338487 17:73455162-73455184 AAGGTGGTCTTCTGGAAGCAGGG + Intronic
1153695104 18:7632224-7632246 ATGGTGTTTTTCTGGATCAATGG + Intronic
1153852583 18:9109993-9110015 ATGCTTTTCTTCTTAAAAAAAGG + Intronic
1155332909 18:24736241-24736263 ATGCTGAGCTTCAGCAAGAATGG - Intergenic
1158752364 18:60277682-60277704 ATGTTGTACTTATTGAAGAAAGG + Intergenic
1158878376 18:61753441-61753463 ATGCTGTTCTTGTGGTAGTGAGG + Intergenic
1159616506 18:70586136-70586158 AAGCTGTCCTTCAGAAAGAAAGG + Intergenic
1160115516 18:76075498-76075520 AAGCTTTTCATCTGGAGGAAGGG - Intergenic
1160336253 18:78042934-78042956 ATGCTGCCCTTTTGGAAGACAGG + Intergenic
1160484075 18:79272307-79272329 ATGCTGTGCCGCTGGAACAAAGG - Intronic
1160512685 18:79461299-79461321 ATGGTGGCCATCTGGAAGAAAGG - Exonic
1161750443 19:6092393-6092415 ATGCTGGGCTGCTGGAAGGAAGG + Intronic
1161930586 19:7336916-7336938 ATGCTGTCATTCAGGAAGACAGG - Intergenic
1162180557 19:8865944-8865966 ATGCTGCTCTTCTGGAACAAGGG + Exonic
1162182013 19:8876408-8876430 AGGCTGCTCCTCTGGAACAAAGG + Exonic
1162522589 19:11190712-11190734 CAGCTGTTCTTCTGGAAACATGG - Intronic
1163819067 19:19485939-19485961 ATGTTGTGCTGCTGGAGGAAAGG - Intronic
1167600605 19:50452377-50452399 ATGATGTGTTTCTGGATGAATGG - Intronic
1167911190 19:52703242-52703264 ATGCTTTTCTTCTCGTATAATGG - Exonic
927462539 2:23311497-23311519 AGTTTGCTCTTCTGGAAGAAGGG - Intergenic
927527657 2:23761559-23761581 ATGCTGTTTTTCTGGTATAAAGG - Intronic
928797420 2:35039446-35039468 ATGCTGTTCTTCTGATAGTGAGG + Intergenic
929287881 2:40156044-40156066 CTTCTGTTCTTCTAGAAGGAAGG - Intronic
929390741 2:41465767-41465789 AAGCTGGTCTTCTGGAAGCCAGG - Intergenic
930278869 2:49345798-49345820 CTGTTGTTCTTCTGGAACAACGG + Intergenic
930292613 2:49514690-49514712 AACGTGTTCTACTGGAAGAATGG + Intergenic
931058757 2:58502732-58502754 TTGCAGTTCTTTTGAAAGAAAGG + Intergenic
932067200 2:68577355-68577377 ATGCTGTTCTTGTGGCAGAGGGG + Intronic
933600053 2:84319818-84319840 ATGCTGCCCTTCTGAGAGAACGG + Intergenic
933675018 2:85047481-85047503 AAGCTCTTCTCATGGAAGAAAGG + Intronic
934634555 2:95972256-95972278 CTGCTTTTCTTCTGGAAGTGTGG + Intronic
934799079 2:97132980-97133002 CTGCTTTTCTTCTGGAAGTGTGG - Intronic
934834359 2:97570491-97570513 CTGCTTTTCTTCTGGAAGTGTGG + Intronic
935270428 2:101429804-101429826 TTGCTGTGCTTCTGGAAGCCGGG + Intronic
935579661 2:104745793-104745815 ATGAAGTTCTTTTGGATGAAGGG - Intergenic
937744537 2:125396010-125396032 TTGTTGTTCTTCTGAAAGATAGG + Intergenic
937750728 2:125473593-125473615 GAGCTGTTCTGCTGGAAGTAAGG - Intergenic
940672922 2:156692867-156692889 ATCCTGTTCGTTTGGAAAAAAGG + Intergenic
941176457 2:162203295-162203317 AAGCTGTTTATCTGAAAGAATGG - Intronic
944261377 2:197681394-197681416 AGGCTGTTCTGTTTGAAGAAAGG - Intergenic
945906460 2:215599254-215599276 ATGCTTTTTTAGTGGAAGAAGGG - Intergenic
945907619 2:215613044-215613066 ATGCTGATCTGCTGGAATGATGG - Intergenic
946807474 2:223485595-223485617 ATGCTGGTCTTCTGGCAAACTGG - Intergenic
946915312 2:224513901-224513923 AGGCTGTTTATCTGGAAGAAGGG + Intronic
947499862 2:230664147-230664169 ATGCTGTTAGTAAGGAAGAAGGG + Intergenic
947757988 2:232582399-232582421 ATGCTTTTTTTCTGAAAGAACGG + Intronic
948050940 2:234978866-234978888 ATGCTGAACCTCTGGAGGAACGG + Exonic
948331035 2:237165606-237165628 TGGCTGTTCTTATGTAAGAAGGG - Intergenic
1170934037 20:20794539-20794561 CAGCTTTTCTTCTAGAAGAATGG + Intergenic
1172992939 20:39049473-39049495 ATGCTGTTTCCCTGGGAGAATGG + Intergenic
1173944121 20:46936684-46936706 CTCCTGTTCTGCTGGGAGAAGGG - Intronic
1174891203 20:54396351-54396373 ATGCTATTCTTCTGAAGCAAGGG - Intergenic
1176066141 20:63196946-63196968 ATGCTTTTCTCCTGGTAGAGGGG - Intronic
1177429952 21:20979268-20979290 ATGCTTTTCTTCTGCAACTATGG + Intergenic
1178809613 21:35869383-35869405 CTGCTTTTCTTTTGGAGGAATGG - Intronic
1180688739 22:17692146-17692168 CTGTTGTTCTTCTGTAAGAAGGG - Intronic
1180990647 22:19933744-19933766 ATGCTGTTCTGTGGGAGGAAGGG + Intronic
1182175132 22:28277900-28277922 ATGCTGTCATTCTGGTATAATGG - Intronic
1182981358 22:34674435-34674457 CTGCTGTTCTTCTAAAAAAATGG - Intergenic
1183306627 22:37086339-37086361 ATGGCGGTCGTCTGGAAGAAGGG - Exonic
1183570625 22:38650676-38650698 ATGCTGTGATTCTAGAATAAGGG + Intronic
1184542329 22:45134789-45134811 ATTCTGTTCCTGTGGAAGAAGGG + Intergenic
1184929146 22:47667838-47667860 CTGCTTTTCTTATGGAAGGAGGG + Intergenic
949284829 3:2389401-2389423 ATTATGTTGTTCTCGAAGAAAGG + Intronic
951267024 3:20579300-20579322 ATTCTGTTCTTCAGAAATAAAGG + Intergenic
955111482 3:55954799-55954821 AGGCTGTTTTACTAGAAGAAGGG - Intronic
955649180 3:61175102-61175124 ATGCTCTTATTGTGGCAGAAGGG + Intronic
957894903 3:86409661-86409683 ATTCTTTTCTTCTGGAAGATGGG - Intergenic
957950907 3:87125240-87125262 ATGCTATTCTTCCTAAAGAATGG + Intergenic
958559907 3:95734148-95734170 ATGCTGTATTTCTATAAGAACGG - Intergenic
959269293 3:104185253-104185275 ATGTGGTTCTTGTGGAAGAGGGG + Intergenic
959392935 3:105798885-105798907 ATGCTGTTGTTCTGGATGGCAGG + Intronic
959532059 3:107444667-107444689 ATGACATTCTTCTGGAAGATAGG + Intergenic
960492227 3:118331948-118331970 ATGCTGTTCTTATGATAGCAAGG + Intergenic
960730056 3:120717360-120717382 ATTGTGTTATTGTGGAAGAATGG - Intronic
964558428 3:157966161-157966183 ATGCAGTTCTTATGGCAAAAAGG - Intergenic
964660898 3:159119187-159119209 ATGCTGAGCTTCTGGAACCAGGG - Intronic
965742963 3:171896005-171896027 ATGCAGTTCATCTGGAAGCTGGG + Intronic
965853534 3:173060844-173060866 ATGCTTTTCTTTTGGAAATATGG + Intronic
966090062 3:176123020-176123042 CTGCTGATCTGATGGAAGAAGGG - Intergenic
966497252 3:180595175-180595197 ATGTTTTTTTTCTTGAAGAAAGG + Intergenic
968260015 3:197313678-197313700 ATTGTTTCCTTCTGGAAGAACGG + Intergenic
969835866 4:9840977-9840999 ATGCTGTTCTTGTGATAGAGAGG - Intronic
971674834 4:29612774-29612796 ATGCTGTTCTTGTGATAGAGAGG - Intergenic
972189908 4:36577402-36577424 AATCTGTTCTTCAGGAATAAGGG + Intergenic
974500841 4:62700082-62700104 ATGCTGTTCCTCTTGAGAAAGGG + Intergenic
975177307 4:71302623-71302645 GTGCTGTGATTCTGGAAGAGAGG + Intronic
978995753 4:115149991-115150013 TTGCTATTCTTATGGAAGACTGG - Intergenic
979931044 4:126630996-126631018 ATGCTGCTTCTCTAGAAGAAAGG + Intergenic
980095044 4:128481104-128481126 ATTCTATTACTCTGGAAGAAGGG - Intergenic
980889159 4:138795732-138795754 ATGCTAATCTTCTGGGAAAAAGG - Intergenic
983250909 4:165345434-165345456 ATTCTATTCTTTTGCAAGAATGG - Intergenic
983741718 4:171142127-171142149 ATGCTTTTGTTCTGGAAGTCAGG - Intergenic
984167890 4:176324581-176324603 ATGCAGATATTCTGGAGGAAAGG + Intronic
984879453 4:184397901-184397923 ATCCTTTTACTCTGGAAGAATGG + Intronic
986200596 5:5574852-5574874 ATTCTGGTCTTATGGAAGTAGGG + Intergenic
986391685 5:7293158-7293180 AAGCTTTTCATCTTGAAGAAGGG + Intergenic
987516574 5:18918004-18918026 ATGCTGTTCTTGTGGTAGTGAGG + Intergenic
988037813 5:25850929-25850951 ATGCTGTTCTCATACAAGAAAGG - Intergenic
988298135 5:29391632-29391654 TTCCTTTTCTTCTGGAAGGAGGG - Intergenic
989580702 5:43030508-43030530 AAGCTTTTCTCCTGGTAGAAAGG + Intergenic
993916352 5:93746960-93746982 AAGCTTTTCTTCTGTAACAAGGG - Intronic
996790061 5:127282730-127282752 TTTCTGTGCTTCTGGAAGGATGG + Intergenic
998983297 5:147727806-147727828 ATTGTGTTTTTCTGGAAAAAAGG + Intronic
999435739 5:151562048-151562070 ATGCTTTTCTCCTGGAAAACAGG - Intronic
999991318 5:157052837-157052859 CTGCTTTTCTTTTGGAAGGAGGG - Intronic
1001701781 5:173712001-173712023 ATGGTCATCTTCTTGAAGAATGG + Intergenic
1002032513 5:176441024-176441046 ATGCTGTTCTTGTGGGAGGGAGG - Intergenic
1005361657 6:25036802-25036824 CTCCTGTTCTTCTGGGAAAATGG - Intronic
1006696562 6:35935517-35935539 TTGCTGTTCTCCTGTAAGTATGG + Intergenic
1007312237 6:40955598-40955620 ATCCTGTTCATCTGTAGGAATGG - Intergenic
1008436014 6:51477540-51477562 TTGTTGTTGTTGTGGAAGAAGGG - Intergenic
1008489161 6:52067478-52067500 ATGCTGATCTTCTCGAGGACAGG - Intronic
1009515898 6:64617201-64617223 ATGTTTTTCTTCTGAAAGAAAGG + Intronic
1010890662 6:81306444-81306466 ATGCTGCTCTTCTGGACTCATGG - Intergenic
1010975968 6:82313740-82313762 ATGCTGTTTTTCTTGAATACTGG - Intergenic
1014056541 6:117022699-117022721 ATGCTATTCTTCTAAAATAAGGG - Intergenic
1014429912 6:121356453-121356475 ATGTAATTCTGCTGGAAGAATGG + Intergenic
1016642343 6:146363430-146363452 ATGCTGTTTATCTGGAAGCTTGG + Intronic
1018373626 6:163191120-163191142 AAGCTGTTCTCCTGGACTAAGGG - Intronic
1018801905 6:167229356-167229378 ATCTTGTTTTTCTGGAAAAAAGG + Intergenic
1019027945 6:168987127-168987149 ATGTTGCTCTTCTGGAGTAAGGG - Intergenic
1020909267 7:14108471-14108493 ATGCTGTTCTTTTGGAATGGGGG + Intergenic
1020919985 7:14251731-14251753 AGGCTGTTCTTCAGTAATAAAGG - Intronic
1022046562 7:26626766-26626788 ATGCTGCTTTGCTGGAACAAGGG + Intergenic
1022184787 7:27956622-27956644 GGACTGCTCTTCTGGAAGAAAGG + Intronic
1022323528 7:29309275-29309297 AGGCTGCTCATCTGGAAGACTGG - Intronic
1022783366 7:33609827-33609849 TAGCTATTCTGCTGGAAGAATGG - Intergenic
1022825622 7:34009654-34009676 CTGCTGCTCTTTTGGAAGAGGGG + Intronic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1023523262 7:41070490-41070512 ATGCTGTGCACCTGGAACAAAGG - Intergenic
1024062601 7:45710106-45710128 CTGCTATTTTTCTGGAAGAGAGG + Intronic
1024937649 7:54727746-54727768 ATGGTATACTTCTGGCAGAATGG - Intergenic
1024958021 7:54946412-54946434 ATGCTGCTCTTTTGGGAGGATGG + Intergenic
1025223135 7:57133216-57133238 ATGCTGTTCTGGTGGTAGTAAGG + Intronic
1025746564 7:64248195-64248217 ATGCTGTTCTTGTGATAGTAAGG - Intronic
1028185937 7:87785298-87785320 AGGCTGGTCTTGTGGAAGGAAGG + Intronic
1029025715 7:97415324-97415346 GTGCTGAACTTTTGGAAGAAAGG - Intergenic
1029618447 7:101674896-101674918 TTGGTTTTCTTCTGGAAGAAAGG + Intergenic
1030479315 7:110082320-110082342 ATTCTGTTCCTCTAGAACAAGGG - Intergenic
1030655355 7:112161665-112161687 ATGCTTTACTTATGGAAGGAAGG + Intronic
1032073895 7:128827209-128827231 ATCCTGTTTTTCTGGAACCAGGG - Intergenic
1032631348 7:133655922-133655944 ATACTGTACTTCTGTAAGACTGG + Intronic
1034594439 7:152176297-152176319 AGGCTGTTCTTCTAGAAGAAGGG + Exonic
1035577960 8:720015-720037 ATGTTGGTCTTCTTGGAGAAGGG - Intronic
1036117167 8:5971141-5971163 ATGCTGTTCTCCTGGTAGCGAGG - Intergenic
1039936203 8:42048381-42048403 ATCCTTTTCATGTGGAAGAAGGG + Exonic
1040503133 8:48022735-48022757 AAGCTGTTCTTCAGAAACAAAGG - Intronic
1040851701 8:51907557-51907579 ATTCTGTTCTTCTTGGAAAATGG - Intergenic
1041381244 8:57256502-57256524 ATGCTGGTCTTCAGGTAGAGTGG + Intergenic
1042382299 8:68130986-68131008 ATGCAATGCATCTGGAAGAAAGG + Intronic
1043800770 8:84606974-84606996 ATGCTGTCCTTCTAGAAGTGGGG + Intronic
1046224867 8:111264715-111264737 ATGCTGTTCTTCCAGAAGAGAGG + Intergenic
1048182413 8:132208272-132208294 ATGCTACTCTGCTGGGAGAAAGG + Intronic
1048613643 8:136050896-136050918 ATGCTGTTCTTGTGATAGAGAGG + Intergenic
1048819818 8:138370279-138370301 ATGCTGTTGTTCAGGATGAATGG + Intronic
1050431496 9:5566912-5566934 CTTCTGTTTTTCTGGAGGAAGGG - Intronic
1051893071 9:21962831-21962853 ATGCTATACTCCTGCAAGAATGG - Intronic
1052698624 9:31910845-31910867 ATGCTGATCTTCTGGGAGCTGGG + Intergenic
1053507656 9:38657470-38657492 ATGTTGTTTTTGGGGAAGAATGG + Intergenic
1058239920 9:102544380-102544402 CTGCTCTTCTTCTGGAATGAGGG - Intergenic
1059071499 9:111142109-111142131 ATGCTTTTCTTCTGGAAGTCTGG - Intergenic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1059524599 9:114978960-114978982 ATGCAGTTCTTCTGCAACAGAGG + Intergenic
1060067152 9:120512604-120512626 ATACTGTGCTTTTGGCAGAAAGG - Intronic
1060795377 9:126509285-126509307 ATTATGTGCTCCTGGAAGAAGGG + Intergenic
1062720048 9:138036112-138036134 AAGCTGTTCTTCAGGCAGAAGGG - Intronic
1185940876 X:4317547-4317569 ATGGTATTCTTCTGGAATCATGG + Intergenic
1186840523 X:13480393-13480415 ATTCTGTTATTATAGAAGAAAGG - Intergenic
1189024742 X:37381078-37381100 CTGCTGTTCTTTTTGGAGAAGGG + Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1191778547 X:64844167-64844189 CTCCTTTTCTTCTGGAAGGAAGG - Intergenic
1194917218 X:99721303-99721325 AAGCTGTTCTTCAGTAATAAAGG + Intergenic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1196802911 X:119559545-119559567 ATACTGGTCTTCTGAACGAAAGG - Intronic
1197346769 X:125333794-125333816 ATGCTGTTCTTGTGACAGTAAGG - Intergenic
1197599362 X:128509181-128509203 ATGCTGCACTTCTGGATGACTGG - Intergenic
1197901254 X:131375325-131375347 ATGAACTTCTTCTGGAAAAATGG + Intronic
1198113272 X:133521632-133521654 ATGCTGTTATTCTTGGAAAACGG + Intergenic
1199730896 X:150631095-150631117 CTGCTTTTCTTCTGGAAGCCTGG - Intronic
1201054659 Y:9976471-9976493 CTCCTGTTCTGCTGGAGGAATGG - Intergenic
1202151036 Y:21844077-21844099 GTGCTACTCTTCTGGAAGAGTGG + Intergenic
1202191724 Y:22252980-22253002 CTCCTGTTCTGCTGGAGGAATGG + Intergenic
1202585943 Y:26427208-26427230 CTGCTTTTCTTCTGGAAGTGTGG - Intergenic