ID: 1098926171

View in Genome Browser
Species Human (GRCh38)
Location 12:76351182-76351204
Sequence CCCATTCTTGCTCTCTGCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 287
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 268}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098926171_1098926180 8 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926180 12:76351213-76351235 AGGGTGGGGGAAAACCAGAGAGG 0: 1
1: 0
2: 3
3: 43
4: 440
1098926171_1098926178 -6 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926178 12:76351199-76351221 AATGGGAAGAAAGGAGGGTGGGG 0: 1
1: 0
2: 7
3: 103
4: 1025
1098926171_1098926181 21 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926181 12:76351226-76351248 ACCAGAGAGGAATGATGTCTCGG 0: 1
1: 0
2: 0
3: 13
4: 155
1098926171_1098926177 -7 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926177 12:76351198-76351220 GAATGGGAAGAAAGGAGGGTGGG 0: 1
1: 0
2: 7
3: 167
4: 1946
1098926171_1098926179 -5 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926179 12:76351200-76351222 ATGGGAAGAAAGGAGGGTGGGGG 0: 1
1: 0
2: 6
3: 135
4: 1329
1098926171_1098926176 -8 Left 1098926171 12:76351182-76351204 CCTGAGCAGAGAGCAAGAATGGG 0: 1
1: 0
2: 0
3: 18
4: 268
Right 1098926176 12:76351197-76351219 AGAATGGGAAGAAAGGAGGGTGG 0: 1
1: 3
2: 51
3: 629
4: 4728

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098926171 Original CRISPR CCCATTCTTGCTCTCTGCTC AGG (reversed) Intergenic
900269531 1:1779898-1779920 CGCATACCTGCTCTCTGGTCAGG + Exonic
901645905 1:10716602-10716624 CCTCTTCTTACTCTCTGCACCGG - Intronic
903008271 1:20312684-20312706 CCCAGTCTGGCTCTCTGCCGAGG + Intronic
903270089 1:22182818-22182840 CCCAAACTTGTGCTCTGCTCCGG + Intergenic
905423676 1:37865979-37866001 CCCTGTCAGGCTCTCTGCTCAGG + Intronic
906111041 1:43322049-43322071 ACTATTCATGCACTCTGCTCTGG - Intronic
906581442 1:46938276-46938298 CAGATTCTTGCTCTCTCCCCAGG + Intronic
908345226 1:63225868-63225890 CACAATCTTGCTCTGTGCCCAGG + Intergenic
908346360 1:63237601-63237623 CACAGTCTTGCTCTGTGCCCAGG - Intergenic
908673684 1:66577221-66577243 GCCTTTCTTGGTCTCTGTTCTGG + Intronic
910651514 1:89573272-89573294 CGGAGTCTTGCTCTGTGCTCAGG - Intronic
911972461 1:104454824-104454846 CCTATTCTTGCTCACTGGGCAGG - Intergenic
912854506 1:113155071-113155093 CCCCTTCTTCCTCTCACCTCTGG + Intergenic
914418885 1:147510199-147510221 CTCTTTCTGGCTCTCTGCACAGG - Intergenic
916125849 1:161570348-161570370 CCCATTCTTTCTCTATTCTCTGG + Intergenic
916135763 1:161652196-161652218 CCCATTCTTTCTCTATTCTCTGG + Intronic
918080560 1:181204696-181204718 CCCTTTTGTACTCTCTGCTCTGG - Intergenic
918341185 1:183569075-183569097 CCCTTTCTTGCCATCAGCTCAGG + Intronic
920694390 1:208170891-208170913 CTCTGTCTTGCTCTCTGCACTGG - Intronic
920700344 1:208213578-208213600 CCCCTTCTTCCTCTCTTTTCTGG + Intronic
920955800 1:210619277-210619299 CCCATTCTTCCTCTTTCTTCTGG + Intronic
921327133 1:213997474-213997496 CCATTTCCTGCTCTCTGATCAGG - Exonic
923110030 1:230883076-230883098 CCCATGCTTTGTCTCTTCTCAGG - Intergenic
923404616 1:233647646-233647668 TCCACTCTGGCTGTCTGCTCTGG + Intronic
1064710658 10:18120917-18120939 CACAGTCTTGCTCTTTGCTCAGG + Intergenic
1065698886 10:28405431-28405453 CCCACTCCTGCCCTCTGCACTGG + Intergenic
1065843015 10:29720870-29720892 CACAGTCTTGCTCTGTGCCCAGG + Intronic
1070546328 10:77455754-77455776 TGCCTTCTGGCTCTCTGCTCTGG - Intronic
1071863859 10:89703776-89703798 CGCAGTCTTGCTCTGTGTTCAGG + Intronic
1072490848 10:95904744-95904766 CCCATTCATTCTGTCTCCTCTGG - Intronic
1072957854 10:99902900-99902922 CAGAATCTTGCTCTCTGCCCAGG - Intronic
1073061635 10:100737003-100737025 CCCTTTCTTCCTCTCTGCACAGG + Intronic
1074915353 10:117950176-117950198 CCCATTCCTGCTACCTGCCCAGG - Intergenic
1075159242 10:120008921-120008943 CCCATTGTTCCTCAATGCTCAGG - Intergenic
1076023747 10:127095149-127095171 CCCTCTTCTGCTCTCTGCTCTGG - Intronic
1077907590 11:6546174-6546196 CCCTGGCTTGCTCTCTGCCCTGG + Exonic
1078170539 11:8925926-8925948 CCCCTTGCTGCTCTCTGCTAGGG - Exonic
1080650090 11:34215312-34215334 CCCTTTCTTCCTCTCTGAGCTGG - Intronic
1081350326 11:42044229-42044251 CTCTATCTTGCACTCTGCTCTGG + Intergenic
1081585280 11:44379972-44379994 CCCATGCCTGCTCTGTCCTCTGG + Intergenic
1081876280 11:46410466-46410488 CCCATCCTTTCTCTCTCCTGGGG + Intronic
1082765854 11:57167114-57167136 CCTTTTCTGGCTCTCTGATCTGG - Intergenic
1083328795 11:61887294-61887316 GCCTCTCTTGCTCTCTGCCCTGG + Intronic
1083581485 11:63827930-63827952 CCCTCCCTTCCTCTCTGCTCTGG + Intergenic
1083887864 11:65581517-65581539 CCCCCTCCTGCTCTCTTCTCAGG + Exonic
1084420755 11:69059382-69059404 CCCATTCTGGGTCCCCGCTCTGG - Intronic
1084539162 11:69775661-69775683 CCCCGTCTCCCTCTCTGCTCCGG + Intergenic
1084665702 11:70575094-70575116 GCCCTCCTTGCTCCCTGCTCTGG + Intronic
1084691873 11:70732321-70732343 CCCATTCACAATCTCTGCTCTGG + Intronic
1085435092 11:76493116-76493138 CCCGCTCCTGCTGTCTGCTCCGG + Intronic
1086501076 11:87454343-87454365 TCCCTTCTTCCTCTCAGCTCAGG - Intergenic
1086535277 11:87836780-87836802 CCCAGTCCTACGCTCTGCTCTGG + Intergenic
1087605039 11:100366804-100366826 CCCATTCTTGGTCTTGGGTCTGG + Intergenic
1088667595 11:112108888-112108910 CGCATTCTTGCTCTCTCGCCAGG - Intronic
1089352152 11:117827957-117827979 CCCATTCCTCCTCCCTGCTCAGG - Intronic
1089620906 11:119721674-119721696 TCCACACCTGCTCTCTGCTCCGG + Intronic
1089743219 11:120599402-120599424 CCCATGCCTGCCCTCTTCTCAGG + Intronic
1090241306 11:125183876-125183898 CCCATTCATGTTCTCCACTCTGG - Intronic
1090507928 11:127339515-127339537 CTCACTCTTGCTCTGAGCTCAGG + Intergenic
1091094863 11:132810855-132810877 CCCATTCTCCCTCTCAGTTCAGG + Intronic
1091394073 12:142918-142940 CCCCTGCTGTCTCTCTGCTCTGG + Intronic
1093547046 12:20360632-20360654 CCTATTTCTGGTCTCTGCTCAGG - Intergenic
1093967861 12:25346017-25346039 CCCATCCTTCCTCCCTTCTCAGG + Intergenic
1095768763 12:45926952-45926974 CACTTTCTCGTTCTCTGCTCTGG + Exonic
1096218061 12:49809308-49809330 CCCATGCCTGGTCTCTGTTCAGG - Intronic
1097282941 12:57856396-57856418 CCCATCCTTGCACTTTCCTCTGG + Intergenic
1098926171 12:76351182-76351204 CCCATTCTTGCTCTCTGCTCAGG - Intergenic
1100628406 12:96361006-96361028 CCCTTTGTTCCTCTCAGCTCTGG - Intronic
1101019694 12:100541305-100541327 CACAGTCTTGCTCTTTGCCCAGG + Intronic
1101973583 12:109335298-109335320 CCCACACCTGCTCCCTGCTCTGG - Intergenic
1102552207 12:113699707-113699729 CCCATTCTGACTCTGGGCTCAGG + Intergenic
1105686826 13:22792364-22792386 CCCATTTCTGCTCTCTGCAGCGG - Intergenic
1105699716 13:22926800-22926822 CCCACGCTCGCTCACTGCTCCGG - Intergenic
1105962681 13:25356232-25356254 CCCATTCTTCCTCAGTGCTGAGG - Intergenic
1106945326 13:34821050-34821072 TCAATTCTGCCTCTCTGCTCTGG + Intergenic
1107013292 13:35689032-35689054 GCCATTCTTGCTATCAGCCCAGG - Intergenic
1107152590 13:37129212-37129234 CTCATTCTTGCTCTCTGTAGAGG + Intergenic
1107746973 13:43520796-43520818 CCTCTTCTTGCTCACTGCTGGGG - Intronic
1108076088 13:46680978-46681000 CCCACTCTTCCTCTTGGCTCTGG - Intronic
1110632246 13:77722770-77722792 CAGATTCTTGCTCTGTGCCCAGG + Intronic
1110767147 13:79293531-79293553 TCCATTCGTGCTGTCTGCTATGG - Intergenic
1112544159 13:100348965-100348987 CTCAGTCTTGCTCTCTCATCCGG + Intronic
1112943379 13:104894072-104894094 GACATTCTTGCTCTCTGGCCAGG + Intergenic
1113616453 13:111684051-111684073 TTCAATCTTGCTCTCAGCTCTGG + Intergenic
1113621983 13:111769322-111769344 TTCAATCTTGCTCTCAGCTCTGG + Intergenic
1114452504 14:22836558-22836580 CCCTCTCTCGCTCTCTCCTCTGG - Exonic
1114472318 14:22972317-22972339 CTCTTTCTTACTCTCTTCTCAGG - Exonic
1118089817 14:62461583-62461605 CCCATTCTCACTCCCTGCTTAGG + Intergenic
1121118332 14:91359187-91359209 CACAGTCTTGCTCTGTGCCCAGG + Intronic
1122261989 14:100529005-100529027 CCCAACCTGGCACTCTGCTCTGG - Intronic
1124034662 15:26044166-26044188 CCCATGCTTGCTCTCAGCACAGG + Intergenic
1124190800 15:27574636-27574658 CCCCTCCTTGGTCTCTGCTCAGG + Intergenic
1127469022 15:59273860-59273882 CCCCTCCCTGCTCACTGCTCGGG + Intronic
1127647369 15:60971964-60971986 CCCATTCTTGTTCTCTCCTTAGG - Intronic
1128520306 15:68370572-68370594 GCCGGTCTGGCTCTCTGCTCAGG + Intronic
1128741389 15:70086202-70086224 TCCATTCTAGCTCTCTGGTGGGG - Intronic
1129305281 15:74656377-74656399 CAGATTCTTGCTCTTTGCCCAGG - Intronic
1130883829 15:88077237-88077259 CCCATTCCTGCTCCCTTCACTGG + Intronic
1133524177 16:6588203-6588225 CACAGTCTTGCTCTGTGCCCAGG - Intronic
1139708738 16:68760559-68760581 CCCATTCTTTCTCTTTAATCTGG + Intronic
1141275961 16:82588442-82588464 CCCAGTCCTGCTCTCTTCTAGGG + Intergenic
1141526323 16:84614314-84614336 CCCAATCTTTCTGCCTGCTCTGG - Intronic
1142308096 16:89296864-89296886 CCCATTCCTGCCCTCTGGTGGGG - Intronic
1142400941 16:89858527-89858549 CCCATTCCTGGTCTCTTTTCAGG - Intronic
1143006429 17:3838219-3838241 CCCATGCTTTATCTCTGGTCAGG - Intronic
1143491376 17:7287002-7287024 TCCTGTCCTGCTCTCTGCTCTGG - Exonic
1144412296 17:15012897-15012919 CCCATTCTTGCACTCCTCTTTGG + Intergenic
1144584599 17:16480699-16480721 CCCATTCTTCCCCTCTCCTGAGG + Intronic
1147216014 17:38899360-38899382 CCCATTGTTGCTCTGGGCTGAGG + Intronic
1147549080 17:41425753-41425775 CCCCTTCTTGCCCTCTCCTTAGG - Intergenic
1148962169 17:51402392-51402414 CCTCTTCTTCCTCTCTGCTGGGG + Intergenic
1149639999 17:58196542-58196564 CCCTTTCTTGCTTGCTGCTTTGG - Intronic
1150442690 17:65203903-65203925 CCCCTTCTTGCTCTCTCTCCTGG + Intronic
1152279590 17:79377612-79377634 GCCGTTCTGGCTCCCTGCTCCGG - Intronic
1153973624 18:10247838-10247860 CGCATTCTTGCTGTCTTCTGTGG - Intergenic
1155558889 18:27053376-27053398 CTCATCCTTGGTGTCTGCTCAGG + Intronic
1156042150 18:32834939-32834961 CCCTTTCCTGCACTCTTCTCTGG - Intergenic
1156307569 18:35892715-35892737 ACCACTCTCGCTCTCTCCTCTGG + Intergenic
1156487852 18:37477934-37477956 CCCACCCCTGCCCTCTGCTCAGG - Intronic
1157403215 18:47403215-47403237 CCAATGCTTCCTCTCTCCTCGGG - Intergenic
1157997066 18:52571348-52571370 CCCATGCTTGCCCTTTTCTCTGG - Intronic
1158554939 18:58467345-58467367 CCCATTTTTTTTCTCTGCACTGG - Intergenic
1160385848 18:78495767-78495789 CCCAGTCCTGCTCTGAGCTCTGG - Intergenic
1162439698 19:10685409-10685431 GTCATTCTGGCTCTCTGCTGAGG + Intronic
1163248675 19:16112727-16112749 ACCATTCCTGCTCTTTTCTCTGG + Intronic
1165907484 19:39202909-39202931 CCCATCCCTGGGCTCTGCTCCGG - Exonic
1166222728 19:41376192-41376214 TTCATTCTTCCTCTCAGCTCCGG - Intronic
1166979825 19:46625751-46625773 CCCCTTCATGCTTTCTTCTCGGG - Intergenic
1168341979 19:55629749-55629771 CATATTCTTGCTCTGTGCCCAGG - Intergenic
925127571 2:1471119-1471141 CCCATTCTTTTACTATGCTCAGG + Intronic
925503709 2:4536214-4536236 CAGATTCTTCCTCTCCGCTCCGG + Intergenic
928278840 2:29926219-29926241 CCAATTCTTGCTCTTGGCCCAGG - Intergenic
929819761 2:45263705-45263727 CCCGAACTTGCTCTATGCTCAGG - Intergenic
929953416 2:46435149-46435171 CCCCTCTTTGCTCTCTCCTCTGG + Intronic
931218345 2:60266365-60266387 CAGAGTCTTGCTCTCTGCCCAGG - Intergenic
931471824 2:62545678-62545700 CCGATTTTTGGTCTCTGCCCTGG + Intergenic
932575944 2:72962409-72962431 CCCAATTTTGCTGTCTTCTCAGG - Intronic
935384276 2:102484893-102484915 CCTACTCTTGCTCCCTCCTCTGG + Intronic
937030752 2:118738056-118738078 GCCATTCTCGCTCTTTGTTCAGG + Intergenic
938231303 2:129662252-129662274 CTCATTCTTGCTCTCTCACCTGG - Intergenic
939168137 2:138661679-138661701 CACTCTCTTGCTCTATGCTCTGG + Intergenic
939484525 2:142793675-142793697 CCCGTGCTTACTCTCTCCTCAGG - Intergenic
939978404 2:148747935-148747957 CCCAGTTTTGCTCTCTGATATGG + Intronic
943371937 2:187026975-187026997 CCCCTTCTCTCTCTCTGCTTTGG + Intergenic
944530403 2:200662404-200662426 CCCATTCTTTGTCTCTACTCTGG - Intronic
944848783 2:203695803-203695825 CCACTTATTGCTCTCTGGTCAGG - Intergenic
945626561 2:212214610-212214632 CCAGTTCTTGCTCTATGTTCTGG - Intronic
948215725 2:236228866-236228888 AATATTCTTGATCTCTGCTCTGG - Intronic
1170771953 20:19340592-19340614 CCCACTCTTCCTCCCTGCCCAGG - Intronic
1172108685 20:32532416-32532438 CCCTTTGTTGCTGTCTTCTCAGG - Intronic
1173705856 20:45110013-45110035 CCCTTTCTTTCTCCCTCCTCAGG - Exonic
1176314204 21:5226962-5226984 TCCCTTCTTGCTCTGTCCTCAGG + Intergenic
1178751640 21:35309825-35309847 CCCATTCTTGCTTTTCTCTCAGG - Intronic
1182194893 22:28506062-28506084 CCCATTCTTCCTCACTGGGCGGG + Intronic
1184578788 22:45398053-45398075 CCCACTCTGGCCCTCAGCTCTGG - Intronic
1185262239 22:49873976-49873998 CTCATTCTTGTTCTCGGCACGGG - Intronic
950535760 3:13577294-13577316 CCCCTTTCAGCTCTCTGCTCGGG - Intronic
950750991 3:15127879-15127901 TCCAGTCTTTCTCTCTCCTCTGG + Intergenic
952252348 3:31666577-31666599 CCCATCCTTGTTCTCTGCAGAGG - Intronic
952750553 3:36821610-36821632 GCCATGCTTGGCCTCTGCTCGGG - Intergenic
953568008 3:44049902-44049924 CCCACTTTGGCTTTCTGCTCAGG - Intergenic
954323490 3:49848079-49848101 CACATTCCTGCTCTCTGCTAAGG + Intronic
955750316 3:62179923-62179945 CTCCTACTTGTTCTCTGCTCTGG - Intronic
955820214 3:62888707-62888729 CCCACTCTTACCCTCTGCTGAGG + Intergenic
957358799 3:79127216-79127238 CCCATTCTTTCTCACTGATGTGG - Intronic
959572086 3:107895551-107895573 CACAATCCTGCTCTCTTCTCTGG - Intergenic
959868571 3:111300300-111300322 CCCTATATTGCTTTCTGCTCTGG + Intronic
959948474 3:112151907-112151929 CCCAGCCTTGCTCCCTGCTGGGG - Exonic
960841385 3:121962971-121962993 CCCATTCTTCCTCACTGGGCAGG + Intergenic
963950048 3:151189514-151189536 CCCATTCTTGTTCTCTCTTTAGG + Intronic
965313082 3:167156158-167156180 CACAATATTGCTCTCTACTCGGG + Intergenic
966676909 3:182599535-182599557 CCCATACTGACTGTCTGCTCAGG - Intergenic
968279372 3:197464506-197464528 CACCTTATTGCCCTCTGCTCAGG - Intergenic
969366280 4:6696278-6696300 CCTGTTCTTCCTCTCTGCTTGGG - Intronic
969652662 4:8477216-8477238 CCCATTTATTCTCACTGCTCAGG - Intronic
969663191 4:8542408-8542430 GACATTCTGGCTCTCTGCCCTGG + Intergenic
970140169 4:12973593-12973615 CTGAATCTTGCTCTCTGCCCAGG - Intergenic
970465916 4:16322927-16322949 CCCCTCCTTGCTCCCTGCTGAGG - Intergenic
970842030 4:20484953-20484975 CTCATTTCTGTTCTCTGCTCAGG + Intronic
970852968 4:20623805-20623827 CCCTTTCTTTCTCTCTATTCTGG - Intergenic
971360816 4:25936796-25936818 CCCATTCTATCTCCCTGCTTGGG + Intergenic
971410262 4:26363461-26363483 CCGATTCTTGCTCTGTTGTCCGG + Intronic
971673884 4:29598924-29598946 CCCATATTGGCGCTCTGCTCTGG + Intergenic
973907817 4:55547949-55547971 TCAATTCTTGCTGTATGCTCTGG + Intergenic
974160995 4:58139029-58139051 CCCTCTCTTGCTGTCTGCCCTGG - Intergenic
974849902 4:67391810-67391832 CCCATCCTTTCTCTCTTCTAGGG - Intergenic
975924436 4:79432088-79432110 CCCATTCTTAAGGTCTGCTCAGG + Intergenic
976187016 4:82452332-82452354 CCGAGTCTTGCTCTTTGCCCAGG + Intronic
978872592 4:113597902-113597924 CCCATTCTTTCCCTTTCCTCAGG - Intronic
981602108 4:146501513-146501535 TCCAATCTTTCTCTCTGCTGTGG + Intronic
981728267 4:147870829-147870851 CCCATTCTTGTTATCTTCTAGGG - Intronic
982691842 4:158556923-158556945 CCCCATCCTTCTCTCTGCTCTGG - Intronic
982919593 4:161256263-161256285 CCCTGTCTTCTTCTCTGCTCTGG - Intergenic
983303115 4:165952864-165952886 CCCATTCTTGCTCTTTAGTGGGG - Intronic
987141945 5:14955362-14955384 TTCATTCTTTGTCTCTGCTCTGG + Intergenic
988128426 5:27073304-27073326 CCCATTCTTTCTCCCTGGGCAGG + Intronic
989107728 5:37879351-37879373 CCCCTTCTGCCCCTCTGCTCTGG + Intergenic
989565783 5:42899429-42899451 CCCAGACTTGCTCTCGGTTCAGG + Intergenic
989573818 5:42971015-42971037 CCCAGGCTTGCTCTCGGTTCAGG - Intergenic
989622313 5:43396893-43396915 CTCTTCCTTGCTCTCTGCTTCGG - Intronic
990033673 5:51292897-51292919 TCCATTCATGCTCTCACCTCAGG - Intergenic
991042283 5:62188323-62188345 CCCCTTCCTGCTCTGTGCTCAGG - Intergenic
991945080 5:71891872-71891894 GCCATTCTTCCTCACTGCTCTGG + Intergenic
993069135 5:83136344-83136366 TCCTTTCTTGCCCTCTGCTCTGG + Intronic
995386526 5:111595690-111595712 CCCACTCTTGGTGCCTGCTCCGG + Intergenic
995428552 5:112049926-112049948 CCCATTCTTCCTCGCTGGGCAGG + Intergenic
995575760 5:113531446-113531468 CACATAATTGCTCTCTACTCAGG - Intronic
996829662 5:127726685-127726707 CCCATCCTTTCTCACTGGTCAGG + Intergenic
996916770 5:128721649-128721671 CTCTTTCTTCCTCTTTGCTCAGG - Intronic
996983490 5:129530302-129530324 CCCATTCTTACTCTCTCCTTCGG - Intronic
997354721 5:133254930-133254952 CCCAGGCCTGGTCTCTGCTCTGG + Intronic
997956879 5:138285745-138285767 CCCCTTCCTGCACTTTGCTCTGG + Exonic
998482095 5:142471176-142471198 CCCCACCTTGCTCTCTGCCCTGG - Intergenic
1001125651 5:169016942-169016964 CCCACTCTTGCTCTGTGACCTGG - Intronic
1002212686 5:177608129-177608151 CCCATTCTTGCACCTGGCTCAGG - Intronic
1003441572 6:6147568-6147590 TCCATTCATTCTCTCTCCTCTGG + Intronic
1003567864 6:7235885-7235907 CCTTTTCTTGCTCCCGGCTCAGG + Intronic
1005451853 6:25981329-25981351 CCCTGTCTTGCTCTGTGCCCAGG - Intronic
1005486998 6:26310084-26310106 CCGCTTCTTGCTCTTTTCTCTGG - Intergenic
1006919185 6:37616241-37616263 CCCCTTGTTGGTCCCTGCTCAGG - Intergenic
1006949209 6:37807821-37807843 CCCATATCTGCTCTCTGCTCTGG - Intergenic
1006963396 6:37957177-37957199 CCCTTTCTTCCTCTCTTTTCAGG + Intronic
1007483326 6:42164144-42164166 CCCATCCTTGCCGTCTCCTCTGG + Intronic
1007694021 6:43720181-43720203 CCCACTCTTGCTGCCTGCTCTGG - Intergenic
1008832537 6:55783508-55783530 CTCACTTGTGCTCTCTGCTCAGG + Intronic
1011255891 6:85420523-85420545 CCTATCCTTGTCCTCTGCTCAGG - Intergenic
1012378060 6:98586332-98586354 CCCACTTTTGCCCTCTGCTGGGG + Intergenic
1013634322 6:112014583-112014605 TCCATTTTTGCTGTTTGCTCTGG - Intergenic
1014899490 6:126945359-126945381 GCCAGTCTTAGTCTCTGCTCAGG + Intergenic
1016583950 6:145662760-145662782 CCCATCCTTGATATCTGATCGGG - Intronic
1017536101 6:155349441-155349463 CCCATTCTTCCTCACTGGGCAGG - Intergenic
1018173590 6:161161006-161161028 CCCTTTCGTGCTCTGTGCTTAGG - Intronic
1018857275 6:167683719-167683741 CCCATTCTTCATCTCTGCCTTGG + Intergenic
1023063954 7:36356487-36356509 CAGATTCTTGCTCTTTGCCCAGG - Intronic
1025073799 7:55925188-55925210 CCCACTCTGGCTCTTTGCTCTGG + Intronic
1026619169 7:71935276-71935298 ACCCTGCTTGCTGTCTGCTCTGG - Intronic
1029650101 7:101885679-101885701 GCCATGCCTGCTCTGTGCTCGGG - Intronic
1029782499 7:102749205-102749227 GCCATGCTTGCCCCCTGCTCAGG + Exonic
1031094155 7:117399202-117399224 CACAGTCTTGCTCTGTGCCCAGG - Intronic
1031236987 7:119189186-119189208 CTCAGTGTTGCTCTCTGCTGTGG - Intergenic
1031474329 7:122204427-122204449 CTCAGTGTTGCTCTCTGCTGTGG + Intergenic
1031867649 7:127055960-127055982 CCCATTCTTTAACTCAGCTCAGG + Intronic
1031961772 7:127996469-127996491 CCCATTCCATCTCTCTGCGCAGG + Intronic
1033245639 7:139714484-139714506 CCCCTTCTTGCTCCCTGTCCGGG - Intronic
1033453440 7:141481774-141481796 TCCATTCTTTCTCTCTTCTAAGG - Intergenic
1034495254 7:151417037-151417059 CCCGTTCCTGCTCTGTGGTCTGG - Intergenic
1036410117 8:8492186-8492208 CGGATTTTTGCTCACTGCTCTGG + Intergenic
1036824101 8:11963020-11963042 CCCATTCTTTCTCTGTCTTCGGG + Intergenic
1037057009 8:14455566-14455588 TCCATTCTTGCTTTCTGACCTGG + Intronic
1039347699 8:36726113-36726135 CGGATTCTTGCTCACTGCTAAGG + Intergenic
1039822022 8:41142801-41142823 CATATTCTTGCTCTGTGTTCTGG - Intergenic
1041403215 8:57466391-57466413 TGCATTATTGCTCTCTACTCAGG + Intergenic
1041624466 8:60009681-60009703 CCCATTCTTTATATCTGCCCTGG - Intergenic
1042597800 8:70468293-70468315 CTCATTCATGGTATCTGCTCTGG + Intergenic
1043090189 8:75891659-75891681 CTCTTTCTTGCTCCTTGCTCTGG - Intergenic
1045051812 8:98334402-98334424 TCCATTTCTGCTCTCTACTCTGG + Intergenic
1045703467 8:104893852-104893874 CACATGCTTGTCCTCTGCTCAGG + Intronic
1047441790 8:124885164-124885186 CCCATCCTTGATATCTGATCAGG - Intergenic
1047476763 8:125239950-125239972 CCCCTTCTTGCTCATTGCTGAGG + Intronic
1047610627 8:126517435-126517457 CATTTTCTTGCTCTCTTCTCTGG + Intergenic
1047663942 8:127069087-127069109 CCATCTCTTTCTCTCTGCTCAGG + Intergenic
1049423275 8:142526162-142526184 CTCCTCCTGGCTCTCTGCTCTGG - Intronic
1050332007 9:4555144-4555166 CCCATGCCTTCTCTCTGCACAGG + Intronic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1050853038 9:10313056-10313078 TCCATTCTTCCTCTCTCCGCAGG + Intronic
1051265770 9:15307175-15307197 CCGACTCCTGCTCTCGGCTCTGG + Exonic
1051694025 9:19749117-19749139 CTCTTTTTTGCTCTCAGCTCAGG + Intronic
1052350047 9:27448990-27449012 CCCATTCCTACCCTCTGCTGAGG + Intronic
1055760460 9:79601680-79601702 CCCCTTCTTTCCCTCTCCTCAGG + Intronic
1057602829 9:96473387-96473409 CCCAGTCCTTCCCTCTGCTCTGG + Intronic
1057704157 9:97385956-97385978 CCCACTCTCACTCTGTGCTCCGG + Intergenic
1057725772 9:97567271-97567293 TCCATTCTGGCCCTCAGCTCAGG + Intronic
1057903035 9:98964213-98964235 CCCATTCTTGGTCTCTAGTTAGG + Intronic
1058681409 9:107443490-107443512 CCCCCTGTTGCTCTCTGCCCAGG + Intergenic
1060542544 9:124440614-124440636 CAGAGTCTTGCTCTGTGCTCAGG - Intergenic
1060718574 9:125957946-125957968 CCAATGCATGCTCTCAGCTCAGG - Intronic
1185660342 X:1722813-1722835 CACAGTCTTGCTCTCTCCCCAGG - Intergenic
1186887768 X:13931795-13931817 CCCATACCTACTCTCTGCTATGG + Intronic
1187209449 X:17214726-17214748 CCCATTCTTTCTCTATCTTCTGG - Intergenic
1187434458 X:19254338-19254360 CTCATTCCTGCTCTCAGCTGGGG - Intergenic
1188237842 X:27751411-27751433 CCCATTCTTCCTCAGTGCTGGGG + Intergenic
1193515781 X:82461323-82461345 TCTATTCTTGCTCTCTGATGTGG + Intergenic
1194013262 X:88587451-88587473 CTCATTATTGGTCTCTGTTCAGG - Intergenic
1195937469 X:110139422-110139444 CCCATCCTCGCTCTCAGCTGAGG - Intronic
1199425782 X:147699225-147699247 TCCATTATTGCTCTCTACTCAGG + Intergenic
1199697316 X:150351986-150352008 CCAACTCCTGCTCTCCGCTCAGG - Intergenic
1199699812 X:150366721-150366743 CCAATGCCTGCTCCCTGCTCTGG + Intronic