ID: 1098937118

View in Genome Browser
Species Human (GRCh38)
Location 12:76492713-76492735
Sequence CAGCTAGATGGTCCATCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098937118_1098937122 -4 Left 1098937118 12:76492713-76492735 CCTCAAGATGGACCATCTAGCTG 0: 1
1: 0
2: 3
3: 8
4: 137
Right 1098937122 12:76492732-76492754 GCTGCAGGAAAACAAGCCCAGGG 0: 3
1: 41
2: 736
3: 773
4: 707
1098937118_1098937121 -5 Left 1098937118 12:76492713-76492735 CCTCAAGATGGACCATCTAGCTG 0: 1
1: 0
2: 3
3: 8
4: 137
Right 1098937121 12:76492731-76492753 AGCTGCAGGAAAACAAGCCCAGG 0: 1
1: 45
2: 776
3: 816
4: 727
1098937118_1098937125 19 Left 1098937118 12:76492713-76492735 CCTCAAGATGGACCATCTAGCTG 0: 1
1: 0
2: 3
3: 8
4: 137
Right 1098937125 12:76492755-76492777 CTCCCACTGATTCTACATTATGG 0: 498
1: 722
2: 496
3: 244
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098937118 Original CRISPR CAGCTAGATGGTCCATCTTG AGG (reversed) Intronic
901216107 1:7556219-7556241 CAGCTAGATGGTGGCCCTTGGGG + Intronic
906243551 1:44257462-44257484 CAGGGTGCTGGTCCATCTTGTGG + Intronic
906355607 1:45104721-45104743 AAGCTAGAGGGCCCTTCTTGCGG + Intronic
908156835 1:61362118-61362140 CTGCCAGATGGTCCTTTTTGGGG + Intronic
908949948 1:69548304-69548326 CAACTAGATGGTCCCATTTGGGG - Intergenic
911763239 1:101640807-101640829 CACCTAGATTTTTCATCTTGAGG - Intergenic
912392619 1:109314918-109314940 CACTGAGATGGTTCATCTTGGGG - Intronic
912960656 1:114192530-114192552 CAGCTGCATGGTCCACCTGGAGG + Intergenic
920388089 1:205581971-205581993 CAGGTAGATGGTCTATGCTGAGG - Intronic
921521803 1:216165636-216165658 CAGCTAAGTGATCCATCTTTTGG + Intronic
924713921 1:246554568-246554590 AAACTAGATGGTCCTACTTGCGG - Intronic
1064115799 10:12576552-12576574 TAACTAGATGGTCCTACTTGGGG + Intronic
1064368169 10:14726973-14726995 CAACTAGATGGTCCCATTTGGGG + Intronic
1064750358 10:18522175-18522197 CAACTAGATGGTCCTTTATGGGG - Intronic
1065474235 10:26117005-26117027 CAGCTGAAAGGTACATCTTGGGG - Intronic
1069581531 10:69570034-69570056 CAGTTTGATGTTCCATCCTGTGG + Intergenic
1071324009 10:84493897-84493919 CAGCTAGATGGTCCTGTCTGGGG + Intronic
1075627929 10:123976587-123976609 CAGTTATTTGCTCCATCTTGTGG - Intergenic
1075682854 10:124344727-124344749 CAGCTAGATGGTCCCATCTGGGG + Intergenic
1078826099 11:14931612-14931634 CAACTAGATGGTCCCTTCTGGGG + Intronic
1079405762 11:20144345-20144367 CAGCTAGATGGTCCCATCTGGGG + Intergenic
1083551916 11:63596571-63596593 CAACTAGATGGTCCCTTCTGGGG + Intronic
1084158893 11:67333689-67333711 CAACTAGATGGTCCTTTCTGGGG - Intronic
1084247987 11:67873284-67873306 CGGCCAGATGGTCCATGTTGGGG + Intergenic
1094053899 12:26249251-26249273 CAACTAGATGGTCCCACCTGGGG + Intronic
1096431275 12:51545270-51545292 CAGCTAGATGGTCCCGTCTGGGG + Intergenic
1098937118 12:76492713-76492735 CAGCTAGATGGTCCATCTTGAGG - Intronic
1100162522 12:91876848-91876870 CAGAGAGATGCTCCATCCTGTGG - Intergenic
1104176039 12:126333593-126333615 CAACTAGATGGCCCATATGGGGG - Intergenic
1113058985 13:106300627-106300649 CAACTAGATGGTCCCATTTGGGG - Intergenic
1118159818 14:63276979-63277001 CAAATAGATGATCCATCCTGTGG + Intronic
1118259546 14:64234571-64234593 CAGCTCGAGGGGCCATCTAGGGG + Intronic
1120456004 14:84731363-84731385 CAGTTAGATGGTATATATTGAGG - Intergenic
1125135640 15:36338059-36338081 TAGCTTTATGGTACATCTTGAGG + Intergenic
1128454276 15:67823824-67823846 GAGCTAGATGGACGAGCTTGGGG - Intronic
1129985110 15:79912162-79912184 CAACTAGATGGTCCCTTCTGGGG - Intronic
1130683416 15:86016238-86016260 CAGCTAGATGGTTCTTCTGCTGG + Intergenic
1132160727 15:99539208-99539230 CAGCTAGATGGCCCAGGGTGGGG + Intergenic
1132486064 16:192003-192025 CAGCTTGAGAGGCCATCTTGAGG - Intronic
1134080340 16:11320463-11320485 CAACTAGATGGTCCCTTCTGGGG - Intronic
1134782550 16:16911540-16911562 CAGGTGGCTGGACCATCTTGGGG - Intergenic
1136012737 16:27374593-27374615 CAGCTAGATGCTGCAGCCTGTGG - Intergenic
1137322921 16:47403916-47403938 CAACTAGATGGTCCCTTCTGAGG - Intronic
1138313721 16:56050358-56050380 CAACTAGATGGTCCCACCTGGGG - Intergenic
1141870630 16:86783127-86783149 CAGCTAGATGGTCCCGTTTGGGG + Intergenic
1147893693 17:43736182-43736204 CAGCTAGATAGTAAATATTGGGG + Intergenic
1149927704 17:60717922-60717944 CAGCTAGATGGTCCCATGTGTGG + Intronic
1150479021 17:65495475-65495497 CGGCTCCTTGGTCCATCTTGTGG - Intergenic
1151881119 17:76895242-76895264 CAACTAGATGGTCCCATTTGGGG - Intronic
1155733875 18:29197125-29197147 CAACTAGATGGTCCCACATGGGG + Intergenic
1155840832 18:30640612-30640634 CAGCTAGATGGTCCCTTCTTGGG - Intergenic
1155849959 18:30761688-30761710 CACATAGATGGTATATCTTGTGG - Intergenic
1156009615 18:32481441-32481463 CAACTAGATGGTCCCACCTGGGG + Intergenic
1157517938 18:48324234-48324256 CAGCTAGATGGTCCATTCCCTGG - Intronic
1158896861 18:61922232-61922254 CAACTAGATGGTCCCATTTGGGG - Intergenic
1162684461 19:12370198-12370220 CAACTAGATGGTCCCTTCTGGGG + Intergenic
1163388842 19:17017233-17017255 CAACTAGATGGTCCCACCTGGGG - Intronic
927547872 2:23970730-23970752 CAACTAGATGGTCCCATTTGGGG + Intronic
927933876 2:27063864-27063886 CAGCCAGATGTTCCATTTTGGGG - Intronic
938282793 2:130077551-130077573 CAACTAGATGGTCCCATTTGGGG + Intronic
938284061 2:130093171-130093193 CAACTAGATGGTCCCTTCTGGGG - Intronic
938333427 2:130466122-130466144 CAACTAGATGGTCCCATTTGGGG + Intronic
938334706 2:130481736-130481758 CAACTAGATGGTCCCTTCTGGGG - Intronic
938355115 2:130638934-130638956 CAACTAGATGGTCCCTTCTGGGG + Intronic
938356386 2:130654549-130654571 CAACTAGATGGTCCCATTTGGGG - Intronic
938431546 2:131245722-131245744 CAACTAGATGGTCCCTTCTGGGG + Intronic
938432820 2:131261354-131261376 CAACTAGATGGTCCCATTTGGGG - Intronic
938475220 2:131604333-131604355 CAACTAGATGGTCCCTTGTGGGG + Intergenic
938796504 2:134721734-134721756 GAGCTAGATGGTCCATATTGTGG - Intergenic
943248149 2:185483028-185483050 CAACTAGATGGTCCAATCTGGGG - Intergenic
1169727620 20:8753141-8753163 CAACTAGATGGTCCCATTTGGGG - Intronic
1171066400 20:22020285-22020307 CATCAAGATGTTCCATTTTGGGG + Intergenic
1171209404 20:23305098-23305120 GAGATAGATGCTTCATCTTGAGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174290233 20:49503202-49503224 CAGCTAGATGGTCCCATCTGGGG + Intergenic
1177308179 21:19348806-19348828 CAGCAAGATAGACCATATTGTGG + Intergenic
1179378286 21:40873272-40873294 CAACTAGATGGTCCCATTTGAGG + Intergenic
1181673550 22:24437330-24437352 CAGCTGGATGGTCAATGTTTGGG + Intronic
952799026 3:37270936-37270958 CAACTAGATGGTCCCTTCTGAGG + Intronic
953531815 3:43746331-43746353 CAGCTAGATGGTCCCATCTGGGG + Intergenic
953925782 3:46981822-46981844 CAGCTAGATGGGGCATCAGGAGG - Intronic
957624873 3:82644039-82644061 CAGTTAGCAGGTGCATCTTGGGG - Intergenic
960407068 3:117274855-117274877 CAGCGAGAAGGGTCATCTTGGGG - Intergenic
961291188 3:125848288-125848310 CGGCTAGACGGTCCAGATTGGGG - Intergenic
962386662 3:134937580-134937602 CAGCATGATGGGCCAGCTTGAGG + Intronic
962697491 3:137964870-137964892 CAGTTAGATGGGACATGTTGAGG + Intergenic
964221512 3:154352254-154352276 CAGTCAGGTGGTCCATCTGGTGG - Intronic
966496889 3:180590837-180590859 CAGCTAGATGGTCCCCTCTGGGG - Intergenic
969686376 4:8676780-8676802 CTGCTAGATGCTCAATGTTGGGG - Intergenic
969746802 4:9079080-9079102 CAGCCAGATGGTCCAGGTTGGGG - Intergenic
971387866 4:26157977-26157999 CAGCTAGATAGTTCATCTGTTGG - Intergenic
972956291 4:44396080-44396102 CAGCTAGATGGTCCCATCTGGGG + Intronic
973275358 4:48301311-48301333 CAACTAGATGGTCCATCTGGGGG - Intergenic
975528467 4:75376494-75376516 CAGCTCTATGTTCCATGTTGAGG - Intergenic
975646936 4:76555019-76555041 CAACTAGATGGTCCCACTGGGGG - Intronic
976529256 4:86132820-86132842 CAGCTAGATGGTCCCATCTGAGG - Intronic
976716691 4:88130379-88130401 CAACTAGATGGTCCCATTTGGGG - Intronic
980668982 4:135979401-135979423 CAGTTAGATCGTCCATCCTAAGG + Intergenic
984252974 4:177356537-177356559 CAGCTATAGTGTTCATCTTGTGG + Intronic
987264995 5:16244090-16244112 CTGCTAGATGCTTCATCTTTGGG - Intergenic
987742610 5:21929354-21929376 CAACTAGATGGTCCCTTCTGGGG + Intronic
992125229 5:73632993-73633015 CAACTAGATGGTCCTACCTGGGG + Intronic
992798010 5:80270635-80270657 GAGCTAGATGGTAAATCTGGAGG - Intergenic
993622357 5:90183719-90183741 CAGCTAAATGGTCCATGGTATGG - Intergenic
994943788 5:106359308-106359330 CAGCTAGATGGTCCCATCTGGGG - Intergenic
995679414 5:114700205-114700227 CAACTAGATGGTCCTATTTGGGG - Intergenic
997817302 5:137031593-137031615 CAGCAAGATGGGCCATGTTTTGG + Intronic
998842745 5:146273222-146273244 CAGCTACATGTTCTATCCTGTGG + Intronic
1000857077 5:166412286-166412308 CAGCTAGATGGTCCCATCTGGGG + Intergenic
1005051268 6:21686066-21686088 CAACTAGATGGTCCCATTTGGGG - Intergenic
1009273017 6:61638999-61639021 CAGCTAGATGCTCCACTTAGAGG - Intergenic
1016785388 6:148005779-148005801 CAACTAGATGGTCCCATTTGGGG + Intergenic
1016845007 6:148561105-148561127 CAACTAGATGGTCCCTTCTGGGG - Intergenic
1016985016 6:149888597-149888619 CAGATAGATGGATCATCCTGGGG - Exonic
1020326650 7:6979497-6979519 CGGCCAGATGGTCCAGGTTGGGG + Intergenic
1021337741 7:19424617-19424639 CATCTTGTTGGCCCATCTTGAGG - Intergenic
1021611379 7:22461061-22461083 CAGCTAGCTGTTCCGTATTGTGG - Intronic
1023199689 7:37682830-37682852 CAACTAGATGGTCCCATTTGGGG - Intergenic
1028649650 7:93137453-93137475 CAACTAGATGGTCCCATTTGGGG - Intronic
1030112793 7:106040917-106040939 CAGCAAGAGGATCCATCTGGGGG - Intergenic
1030661248 7:112221603-112221625 CAACTAGACAGTCCATCTGGGGG + Intronic
1031110275 7:117598851-117598873 CAGCTACATAGGCCATTTTGTGG + Intronic
1031228605 7:119074827-119074849 CAACTAGATGGTCCCTTCTGGGG - Intergenic
1033104026 7:138502781-138502803 TAGATAGATCTTCCATCTTGAGG + Intronic
1033808861 7:144986228-144986250 CAGCTAGATGGTCCCATCTGTGG + Intergenic
1035971544 8:4254826-4254848 CACCTAGATGGTACAGCCTGTGG - Intronic
1040082727 8:43305026-43305048 CAACTAGATGTCCCATCTGGGGG + Intergenic
1043005591 8:74814497-74814519 CAGCTAGATGGTCCCATCTGGGG + Intronic
1044686319 8:94829307-94829329 CAACTAGATGGTCCCATTTGGGG + Intronic
1045324555 8:101108772-101108794 CAGCAAGCTGGTGCATCTTGTGG - Intergenic
1045625711 8:104047117-104047139 CAGCTATTTGTTCCATGTTGGGG - Intronic
1045676580 8:104614519-104614541 CAACTAGATGGTCCCTTCTGGGG + Intronic
1046739511 8:117813295-117813317 CAGCTAGTTGCTCCATCCTGTGG - Intronic
1048071819 8:131029228-131029250 CAGCTAGATGGTCCCATCTGGGG - Intronic
1048258442 8:132924113-132924135 CAACTAGATGGTCCCATTTGGGG + Intronic
1048604149 8:135950183-135950205 CAGCTTGATGCCCCAGCTTGGGG + Intergenic
1050164182 9:2747069-2747091 CAACCAGGTGGTCCATCTGGAGG - Intronic
1057108790 9:92447313-92447335 CAACTAGATGGTCCCACCTGGGG + Intronic
1058131081 9:101254253-101254275 CAACTAGACAGTCCATCTAGGGG + Intronic
1059781544 9:117533502-117533524 AAGATAGATGGCCCGTCTTGAGG + Intergenic
1059800624 9:117746190-117746212 CAACTAGATGGTCCCATTTGGGG + Intergenic
1061438560 9:130582866-130582888 CAGCTAGCTGGTCCAGCTTGTGG - Intronic
1062211581 9:135367114-135367136 CAGGTGGATGATCCATTTTGAGG - Intergenic
1062284196 9:135765886-135765908 CACCTAGATGGTCCACCCTGGGG - Intronic
1188621847 X:32235188-32235210 CAGCTAGATGGTCCCATCTGGGG + Intronic
1193221923 X:78935764-78935786 CAACTAGATTGTCCATGGTGAGG + Intergenic
1197726371 X:129779634-129779656 CAGCCAGATGGTCCAACTTCTGG + Intergenic
1198813921 X:140566608-140566630 CAGCTAGATGGTCCCATCTGGGG + Intergenic
1201238341 Y:11933288-11933310 CAACTAGATGGTCCCACTAGGGG + Intergenic