ID: 1098942909

View in Genome Browser
Species Human (GRCh38)
Location 12:76558878-76558900
Sequence CTCCTACGTTACAAGAAGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 62}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098942909 Original CRISPR CTCCTACGTTACAAGAAGGC CGG Intronic
904573544 1:31486383-31486405 CACCTTCTTTACAAGACGGCAGG - Intergenic
907796141 1:57719638-57719660 CACCTTCTTTACAAGATGGCAGG - Intronic
916987399 1:170206589-170206611 ATCCTTCTTCACAAGAAGGCAGG - Intergenic
918072853 1:181146101-181146123 ATCCTCCACTACAAGAAGGCAGG - Intergenic
922580093 1:226690724-226690746 CACCTACCTCACAAGCAGGCAGG + Intronic
1063201433 10:3787823-3787845 CTCATATGTTAAAAGAAGGGTGG - Intergenic
1069816422 10:71197549-71197571 CACCTACTTTACAAGGTGGCAGG - Intergenic
1071951436 10:90707388-90707410 CACCTTCCTCACAAGAAGGCAGG - Intergenic
1075570408 10:123537826-123537848 CCACTACATAACAAGAAGGCTGG - Intergenic
1084344096 11:68532315-68532337 GTCTTACGTTACAGGAAGGTGGG + Intronic
1094799665 12:34018653-34018675 CACCTTCTTTACAAGATGGCAGG + Intergenic
1098942909 12:76558878-76558900 CTCCTACGTTACAAGAAGGCCGG + Intronic
1107399413 13:40054758-40054780 CTCCTGCATTACAAGAACACTGG + Intergenic
1112041692 13:95553367-95553389 CCCCTACGTTCCCCGAAGGCTGG + Intronic
1113600015 13:111561892-111561914 CTCCCAGGGTACAAGAATGCTGG + Intergenic
1123696704 15:22883923-22883945 CACCTTCTTCACAAGAAGGCAGG + Intronic
1132265000 15:100461958-100461980 CTTCTACGCTAAAAGAAGACTGG + Intronic
1138351193 16:56347158-56347180 CTCCTCCTTTTCAAGAAGTCTGG + Exonic
1154194841 18:12258059-12258081 CTCCTCCTTGACAAGAAGGTGGG + Intronic
1158398373 18:57097707-57097729 TTCCTAGGTAACAAGAAGGGAGG + Intergenic
1168026323 19:53646362-53646384 CACTTACGTTACAGGAAGGAGGG - Intergenic
928177869 2:29047162-29047184 CTCTTACCTTACGGGAAGGCAGG + Intronic
936964927 2:118118098-118118120 CTCTTATGTAAAAAGAAGGCCGG + Intergenic
938695587 2:133832580-133832602 CTCCTACTTTCAAGGAAGGCTGG - Intergenic
941879769 2:170469285-170469307 CACCTGCATGACAAGAAGGCAGG + Intronic
943762808 2:191628442-191628464 CACCTACGTGAAAGGAAGGCTGG - Intergenic
947017941 2:225642158-225642180 ATCCTACAGTAAAAGAAGGCAGG + Intronic
1170184679 20:13575487-13575509 CTCTTACATTACATGATGGCAGG - Intronic
1175785817 20:61711217-61711239 ATCCTCCTTCACAAGAAGGCAGG - Intronic
949575112 3:5331359-5331381 CACCTTCTTTACAAGACGGCCGG + Intergenic
963750013 3:149167594-149167616 CTCCTATGTGGCAAGAAGGAAGG - Intronic
965478145 3:169183678-169183700 TTCCTGCCTTCCAAGAAGGCAGG + Intronic
965839070 3:172882397-172882419 CTTATACTTTACAACAAGGCAGG - Intergenic
971779081 4:31007146-31007168 CTCCTACATTACAAGCTGTCTGG + Intronic
974832529 4:67206970-67206992 CACCTTCTTCACAAGAAGGCAGG + Intergenic
977393590 4:96445390-96445412 CACCTTCTTTACAAGAGGGCAGG - Intergenic
977421800 4:96810206-96810228 CTCATAGGATACAAGAAGGTGGG + Intergenic
979681754 4:123467553-123467575 CTCCTGCCTTGCAGGAAGGCGGG - Intergenic
981392612 4:144209529-144209551 CACCTTCTTTACAAGATGGCAGG + Intergenic
986364333 5:7015901-7015923 CTCCTAGGTACCAAGGAGGCTGG - Intergenic
988817264 5:34846738-34846760 CTCTTAGGTAACAAAAAGGCTGG + Intronic
995747692 5:115421131-115421153 CTCCTGCATTACAAGAACACTGG + Intergenic
997594659 5:135098794-135098816 CTCCTAAGTGACTAGCAGGCAGG + Intronic
998989251 5:147797117-147797139 CTACTACGTTACTAACAGGCAGG - Intergenic
1004216515 6:13710098-13710120 CTCCTAGGTTAAAACAAAGCTGG - Intronic
1013620267 6:111880834-111880856 GTCCTTCTTCACAAGAAGGCAGG - Intergenic
1017001055 6:149997861-149997883 CTCTTAATTTACAAGCAGGCTGG - Intergenic
1019835788 7:3381721-3381743 CTCCTTCCCTAAAAGAAGGCAGG + Intronic
1022352162 7:29576572-29576594 CACCTTCTTTACAAGATGGCAGG - Intergenic
1026427811 7:70314028-70314050 CTCCTGCTTAAAAAGAAGGCAGG - Intronic
1029052905 7:97708296-97708318 CACCTTCCTTACAAGATGGCAGG - Intergenic
1031457191 7:121996430-121996452 TTCCCATGTAACAAGAAGGCTGG - Exonic
1032174599 7:129612466-129612488 CTCCTAACTTGCAAGAAGGTGGG - Intronic
1034496383 7:151425576-151425598 CTCTTACATAACAAGAAGGGTGG + Intergenic
1035330742 7:158095712-158095734 CTCCTACGCTCCTTGAAGGCAGG - Intronic
1035704745 8:1667024-1667046 CACCTACGTCACAAGCAGCCTGG + Intronic
1038105303 8:24427108-24427130 CTATTATATTACAAGAAGGCAGG - Intergenic
1041750912 8:61260094-61260116 ATCCTACGTTACATGACGGAGGG - Intronic
1045273208 8:100679465-100679487 ATCCTAAGATACAAGGAGGCAGG - Intergenic
1049143905 8:140983608-140983630 TTCCTCCAGTACAAGAAGGCTGG + Intronic
1052395347 9:27931568-27931590 CACCTTCTTTACAAGACGGCAGG + Intergenic
1201856376 Y:18548904-18548926 TTTCTACGTTACAACATGGCAGG + Intronic
1201876945 Y:18771480-18771502 TTTCTACGTTACAACATGGCAGG - Intronic