ID: 1098944058

View in Genome Browser
Species Human (GRCh38)
Location 12:76570963-76570985
Sequence CAGGGTAACCAAATAGTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098944058_1098944060 -5 Left 1098944058 12:76570963-76570985 CCTGGAACTATTTGGTTACCCTG No data
Right 1098944060 12:76570981-76571003 CCCTGAAATATAACTCCTACTGG No data
1098944058_1098944062 0 Left 1098944058 12:76570963-76570985 CCTGGAACTATTTGGTTACCCTG No data
Right 1098944062 12:76570986-76571008 AAATATAACTCCTACTGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098944058 Original CRISPR CAGGGTAACCAAATAGTTCC AGG (reversed) Intergenic
No off target data available for this crispr