ID: 1098949435

View in Genome Browser
Species Human (GRCh38)
Location 12:76624266-76624288
Sequence GTTCCCACCATTCCCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1098949435_1098949441 14 Left 1098949435 12:76624266-76624288 CCAGTTCTGGGAATGGTGGGAAC No data
Right 1098949441 12:76624303-76624325 AGTTCCCAGATGCCAGCCAAGGG 0: 16
1: 57
2: 98
3: 155
4: 320
1098949435_1098949440 13 Left 1098949435 12:76624266-76624288 CCAGTTCTGGGAATGGTGGGAAC No data
Right 1098949440 12:76624302-76624324 AAGTTCCCAGATGCCAGCCAAGG 0: 18
1: 49
2: 108
3: 151
4: 399
1098949435_1098949443 18 Left 1098949435 12:76624266-76624288 CCAGTTCTGGGAATGGTGGGAAC No data
Right 1098949443 12:76624307-76624329 CCCAGATGCCAGCCAAGGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1098949435 Original CRISPR GTTCCCACCATTCCCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr